Mutagenetix > Incidental Mutations

Incidental Mutation 'R1452:Nphp4'

161063

Institutional Source

Beutler Lab

Gene Symbol

Nphp4

Ensembl Gene

ENSMUSG00000039577

Gene Name

nephronophthisis 4 (juvenile) homolog (human)

Synonyms

nmf192, 4930564O18Rik

MMRRC Submission

039507-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.142) question?

Stock #

R1452 (G1)

Quality Score

185

Status

Validated

Chromosome

Chromosomal Location

152476706-152563183 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 152547018 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Glutamic Acid at position 792 (Q792E)

Ref Sequence

ENSEMBL: ENSMUSP00000080128 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]

AlphaFold

P59240

Predicted Effect

probably damaging
Transcript: ENSMUST00000056567
AA Change: Q792E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: Q792E

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081393
AA Change: Q792E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: Q792E

Domain	Start	End	E-Value	Type
low complexity region	317	333	N/A	INTRINSIC
low complexity region	367	380	N/A	INTRINSIC
low complexity region	473	484	N/A	INTRINSIC
low complexity region	507	530	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142027

Meta Mutation Damage Score

0.1384

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.8%
20x: 87.5%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,939	Y415C	probably damaging	Het
2810474O19Rik	A	T	6: 149,326,632	K392I	probably damaging	Het
A2m	A	G	6: 121,678,056	I1446M	probably benign	Het
Acaca	T	A	11: 84,295,059		probably benign	Het
Adgre4	A	T	17: 55,784,996	E85D	probably benign	Het
Akt3	A	T	1: 177,131,067	Y26N	possibly damaging	Het
Arl15	T	C	13: 113,967,783	V132A	probably benign	Het
Atp6v1h	A	G	1: 5,098,137		probably benign	Het
Atrip	T	A	9: 109,072,659	D110V	probably damaging	Het
Bahcc1	T	G	11: 120,282,239		probably benign	Het
Cd53	C	T	3: 106,768,959	G31S	probably damaging	Het
Cdk14	T	C	5: 4,888,927	S404G	possibly damaging	Het
Cers3	A	T	7: 66,783,404	K156N	probably damaging	Het
Colgalt2	C	A	1: 152,504,153	L448M	probably damaging	Het
Cox15	G	T	19: 43,746,905	T141K	probably damaging	Het
Csnk2a2	C	T	8: 95,457,375		probably benign	Het
Cyp2b10	A	T	7: 25,925,388		probably benign	Het
Cyp2c55	A	G	19: 39,011,090	Y80C	probably damaging	Het
Depdc1a	A	G	3: 159,526,691	Y693C	possibly damaging	Het
Des	T	C	1: 75,363,477	S343P	probably damaging	Het
Dync1i2	T	C	2: 71,249,863		probably benign	Het
Eif3m	T	A	2: 105,006,777	Q199L	probably damaging	Het
Emsy	G	T	7: 98,600,674	T802K	probably damaging	Het
Endov	A	G	11: 119,491,825	T33A	probably damaging	Het
Epb41l5	G	A	1: 119,549,166	T728I	probably damaging	Het
Fbxo39	A	G	11: 72,318,402	I363V	probably benign	Het
Gm8674	C	T	13: 49,900,517		noncoding transcript	Het
Gm9733	G	T	3: 15,332,152	T24K	unknown	Het
Il6st	T	A	13: 112,481,464	N137K	possibly damaging	Het
Inf2	A	G	12: 112,601,344	N136S	probably damaging	Het
Iqub	A	T	6: 24,491,559	I376N	probably benign	Het
Kansl3	A	G	1: 36,354,793		probably benign	Het
Kbtbd2	A	T	6: 56,781,924	H71Q	probably damaging	Het
Lgals8	G	T	13: 12,453,327	Y140*	probably null	Het
Macf1	T	A	4: 123,493,998	I924L	probably benign	Het
Mcoln2	A	T	3: 146,181,814	T329S	possibly damaging	Het
Mex3d	A	T	10: 80,381,520	L621Q	probably damaging	Het
Mut	A	G	17: 40,937,468		probably benign	Het
Ncor1	T	C	11: 62,334,631	H1038R	probably damaging	Het
Neb	A	G	2: 52,271,297		probably null	Het
Ngrn	A	G	7: 80,264,772	T224A	probably benign	Het
Nin	G	A	12: 70,017,650	R2019*	probably null	Het
Olfr1047	T	A	2: 86,228,455	N172I	probably damaging	Het
Olfr1166	C	T	2: 88,124,311	V225I	probably benign	Het
Olfr140	C	T	2: 90,051,671	V218I	possibly damaging	Het
Olfr373	C	T	8: 72,100,176	Q139*	probably null	Het
Olfr70	C	T	4: 43,696,823	V117M	probably benign	Het
Pde4dip	C	A	3: 97,724,102	V1164L	probably damaging	Het
Plppr1	A	G	4: 49,301,067		probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Ppp2r5e	A	G	12: 75,469,536		probably benign	Het
Prim2	T	A	1: 33,630,404	E163D	probably benign	Het
Prrc2b	A	T	2: 32,194,985	D296V	probably damaging	Het
Pter	A	G	2: 12,978,621		probably benign	Het
Robo2	C	A	16: 73,961,910	V662L	probably damaging	Het
Slco1b2	A	T	6: 141,672,200	I424F	probably benign	Het
Snx29	A	T	16: 11,631,471	H260L	probably damaging	Het
Stil	A	G	4: 115,039,195	N959S	probably benign	Het
Taar8c	A	T	10: 24,101,610	D101E	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	G	A	9: 8,653,147	M573I	probably damaging	Het
Tsr1	A	T	11: 74,899,599	D171V	probably benign	Het
Ube4b	T	C	4: 149,371,169	T348A	probably damaging	Het
Vmn1r85	A	T	7: 13,084,881	I112N	probably damaging	Het
Vps36	A	G	8: 22,218,210		probably null	Het
Wdfy3	G	A	5: 101,937,738	A630V	possibly damaging	Het
Wdsub1	A	T	2: 59,876,800	D14E	probably null	Het
Ylpm1	T	C	12: 85,030,383	I1294T	possibly damaging	Het
Zdhhc17	A	G	10: 110,955,075	F378L	probably benign	Het

Other mutations in Nphp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Nphp4	APN	4	152537309	splice site	probably benign
IGL00963:Nphp4	APN	4	152537861	missense	probably benign	0.01
IGL01571:Nphp4	APN	4	152556382	missense	probably benign	0.21
IGL01707:Nphp4	APN	4	152538983	missense	probably benign	0.00
IGL01837:Nphp4	APN	4	152488881	missense	probably damaging	0.96
IGL02341:Nphp4	APN	4	152555469	splice site	probably benign
IGL02558:Nphp4	APN	4	152555531	missense	probably damaging	1.00
IGL02563:Nphp4	APN	4	152556220	missense	probably benign	0.00
IGL02712:Nphp4	APN	4	152556275	missense	probably damaging	1.00
IGL03023:Nphp4	APN	4	152524235	splice site	probably null
R0280:Nphp4	UTSW	4	152551936	splice site	probably benign
R0317:Nphp4	UTSW	4	152551931	critical splice donor site	probably null
R0410:Nphp4	UTSW	4	152557046	missense	probably benign
R0433:Nphp4	UTSW	4	152518172	missense	probably benign	0.00
R0706:Nphp4	UTSW	4	152555617	missense	probably damaging	0.98
R0785:Nphp4	UTSW	4	152562109	missense	possibly damaging	0.58
R0890:Nphp4	UTSW	4	152498220	missense	possibly damaging	0.93
R0930:Nphp4	UTSW	4	152538055	missense	probably benign	0.01
R1202:Nphp4	UTSW	4	152488729	splice site	probably null
R1203:Nphp4	UTSW	4	152488832	missense	probably damaging	0.96
R1366:Nphp4	UTSW	4	152502926	missense	probably damaging	0.96
R1598:Nphp4	UTSW	4	152562090	missense	probably benign	0.00
R1699:Nphp4	UTSW	4	152496664	missense	probably damaging	0.99
R2007:Nphp4	UTSW	4	152554654	missense	probably damaging	0.97
R2082:Nphp4	UTSW	4	152559364	missense	probably benign	0.38
R2264:Nphp4	UTSW	4	152503008	splice site	probably benign
R2280:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2281:Nphp4	UTSW	4	152557043	missense	possibly damaging	0.95
R2926:Nphp4	UTSW	4	152518139	missense	probably damaging	0.99
R3764:Nphp4	UTSW	4	152538017	splice site	probably benign
R4084:Nphp4	UTSW	4	152488791	missense	probably damaging	1.00
R4091:Nphp4	UTSW	4	152547018	missense	probably damaging	0.97
R4240:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R4701:Nphp4	UTSW	4	152496659	missense	probably damaging	1.00
R4778:Nphp4	UTSW	4	152556291	missense	probably benign	0.44
R4783:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4784:Nphp4	UTSW	4	152554546	missense	probably benign	0.00
R4974:Nphp4	UTSW	4	152537793	missense	probably damaging	1.00
R5053:Nphp4	UTSW	4	152544462	splice site	probably null
R5117:Nphp4	UTSW	4	152524232	splice site	probably null
R5128:Nphp4	UTSW	4	152502991	missense	probably benign	0.01
R5665:Nphp4	UTSW	4	152506485	missense	probably benign	0.25
R5890:Nphp4	UTSW	4	152547079	missense	probably benign	0.44
R6171:Nphp4	UTSW	4	152544449	missense	probably damaging	0.99
R6601:Nphp4	UTSW	4	152503007	splice site	probably null
R6772:Nphp4	UTSW	4	152544406	missense	probably benign	0.07
R6806:Nphp4	UTSW	4	152538101	missense	probably benign	0.02
R7006:Nphp4	UTSW	4	152488802	missense	probably benign	0.12
R7124:Nphp4	UTSW	4	152555684	missense	probably benign	0.07
R7381:Nphp4	UTSW	4	152499003	missense	possibly damaging	0.94
R7411:Nphp4	UTSW	4	152554717	missense	probably benign	0.25
R7638:Nphp4	UTSW	4	152554534	missense	probably benign	0.08
R7814:Nphp4	UTSW	4	152524272	missense	possibly damaging	0.93
R7814:Nphp4	UTSW	4	152544403	missense	probably damaging	1.00
R7841:Nphp4	UTSW	4	152496683	missense	probably benign	0.01
R8346:Nphp4	UTSW	4	152561321	missense	probably damaging	1.00
R8479:Nphp4	UTSW	4	152524290	missense	probably benign	0.01
R8847:Nphp4	UTSW	4	152506406	missense	probably damaging	1.00
R8995:Nphp4	UTSW	4	152538888	missense	probably damaging	1.00
R8997:Nphp4	UTSW	4	152538888	missense	probably damaging	1.00
R9075:Nphp4	UTSW	4	152507448	missense	probably damaging	1.00
R9089:Nphp4	UTSW	4	152561216	missense	possibly damaging	0.87
R9191:Nphp4	UTSW	4	152556230	missense	probably damaging	1.00
R9274:Nphp4	UTSW	4	152555599	missense	probably benign	0.05
R9311:Nphp4	UTSW	4	152524257	missense	probably damaging	0.99
R9383:Nphp4	UTSW	4	152544461	critical splice donor site	probably null
T0970:Nphp4	UTSW	4	152556379	missense	probably damaging	1.00
X0058:Nphp4	UTSW	4	152559707	missense	possibly damaging	0.95
Z1177:Nphp4	UTSW	4	152518196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCACAGTGCCACCCAGTGTTTATTC -3'
(R):5'- TTCCAAGCTCCTGTCAGGACAGTG -3'

Sequencing Primer
(F):5'- GTGACAGCTCTGTCCCTGATG -3'
(R):5'- ACCGTGTTGGTTTCCTACAAAG -3'

Posted On

2014-03-14