Mutagenetix > Incidental Mutations

Incidental Mutation 'R1452:A2m'

161068

Institutional Source

Beutler Lab

Gene Symbol

A2m

Ensembl Gene

ENSMUSG00000030111

Gene Name

alpha-2-macroglobulin

Synonyms

A2mp

MMRRC Submission

039507-MU

Accession Numbers

NCBI RefSeq: NM_175628.3; MGI:2449119

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1452 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121635376-121679227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121678056 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 1446 (I1446M)

Ref Sequence

ENSEMBL: ENSMUSP00000032203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032203]

Predicted Effect

probably benign
Transcript: ENSMUST00000032203
AA Change: I1446M

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000032203
Gene: ENSMUSG00000030111
AA Change: I1446M

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
Pfam:A2M_N	134	227	2.1e-20	PFAM
low complexity region	334	347	N/A	INTRINSIC
A2M_N_2	465	613	2.04e-31	SMART
low complexity region	722	731	N/A	INTRINSIC
A2M	738	828	2.31e-39	SMART
Pfam:Thiol-ester_cl	961	990	4.4e-18	PFAM
Pfam:A2M_comp	1010	1266	1.4e-98	PFAM
A2M_recep	1376	1463	2.69e-40	SMART

Meta Mutation Damage Score

0.1455

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.8%
20x: 87.5%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protease inhibitor and cytokine transporter. It uses a bait-and-trap mechanism to inhibit a broad spectrum of proteases, including trypsin, thrombin and collagenase. It can also inhibit inflammatory cytokines, and it thus disrupts inflammatory cascades. Mutations in this gene are a cause of alpha-2-macroglobulin deficiency. This gene is implicated in Alzheimer's disease (AD) due to its ability to mediate the clearance and degradation of A-beta, the major component of beta-amyloid deposits. A related pseudogene, which is also located on the p arm of chromosome 12, has been identified. [provided by RefSeq, Nov 2016]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,939	Y415C	probably damaging	Het
2810474O19Rik	A	T	6: 149,326,632	K392I	probably damaging	Het
Acaca	T	A	11: 84,295,059		probably benign	Het
Adgre4	A	T	17: 55,784,996	E85D	probably benign	Het
Akt3	A	T	1: 177,131,067	Y26N	possibly damaging	Het
Arl15	T	C	13: 113,967,783	V132A	probably benign	Het
Atp6v1h	A	G	1: 5,098,137		probably benign	Het
Atrip	T	A	9: 109,072,659	D110V	probably damaging	Het
Bahcc1	T	G	11: 120,282,239		probably benign	Het
Cd53	C	T	3: 106,768,959	G31S	probably damaging	Het
Cdk14	T	C	5: 4,888,927	S404G	possibly damaging	Het
Cers3	A	T	7: 66,783,404	K156N	probably damaging	Het
Colgalt2	C	A	1: 152,504,153	L448M	probably damaging	Het
Cox15	G	T	19: 43,746,905	T141K	probably damaging	Het
Csnk2a2	C	T	8: 95,457,375		probably benign	Het
Cyp2b10	A	T	7: 25,925,388		probably benign	Het
Cyp2c55	A	G	19: 39,011,090	Y80C	probably damaging	Het
Depdc1a	A	G	3: 159,526,691	Y693C	possibly damaging	Het
Des	T	C	1: 75,363,477	S343P	probably damaging	Het
Dync1i2	T	C	2: 71,249,863		probably benign	Het
Eif3m	T	A	2: 105,006,777	Q199L	probably damaging	Het
Emsy	G	T	7: 98,600,674	T802K	probably damaging	Het
Endov	A	G	11: 119,491,825	T33A	probably damaging	Het
Epb41l5	G	A	1: 119,549,166	T728I	probably damaging	Het
Fbxo39	A	G	11: 72,318,402	I363V	probably benign	Het
Gm8674	C	T	13: 49,900,517		noncoding transcript	Het
Gm9733	G	T	3: 15,332,152	T24K	unknown	Het
Il6st	T	A	13: 112,481,464	N137K	possibly damaging	Het
Inf2	A	G	12: 112,601,344	N136S	probably damaging	Het
Iqub	A	T	6: 24,491,559	I376N	probably benign	Het
Kansl3	A	G	1: 36,354,793		probably benign	Het
Kbtbd2	A	T	6: 56,781,924	H71Q	probably damaging	Het
Lgals8	G	T	13: 12,453,327	Y140*	probably null	Het
Macf1	T	A	4: 123,493,998	I924L	probably benign	Het
Mcoln2	A	T	3: 146,181,814	T329S	possibly damaging	Het
Mex3d	A	T	10: 80,381,520	L621Q	probably damaging	Het
Mut	A	G	17: 40,937,468		probably benign	Het
Ncor1	T	C	11: 62,334,631	H1038R	probably damaging	Het
Neb	A	G	2: 52,271,297		probably null	Het
Ngrn	A	G	7: 80,264,772	T224A	probably benign	Het
Nin	G	A	12: 70,017,650	R2019*	probably null	Het
Nphp4	C	G	4: 152,547,018	Q792E	probably damaging	Het
Olfr1047	T	A	2: 86,228,455	N172I	probably damaging	Het
Olfr1166	C	T	2: 88,124,311	V225I	probably benign	Het
Olfr140	C	T	2: 90,051,671	V218I	possibly damaging	Het
Olfr373	C	T	8: 72,100,176	Q139*	probably null	Het
Olfr70	C	T	4: 43,696,823	V117M	probably benign	Het
Pde4dip	C	A	3: 97,724,102	V1164L	probably damaging	Het
Plppr1	A	G	4: 49,301,067		probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Ppp2r5e	A	G	12: 75,469,536		probably benign	Het
Prim2	T	A	1: 33,630,404	E163D	probably benign	Het
Prrc2b	A	T	2: 32,194,985	D296V	probably damaging	Het
Pter	A	G	2: 12,978,621		probably benign	Het
Robo2	C	A	16: 73,961,910	V662L	probably damaging	Het
Slco1b2	A	T	6: 141,672,200	I424F	probably benign	Het
Snx29	A	T	16: 11,631,471	H260L	probably damaging	Het
Stil	A	G	4: 115,039,195	N959S	probably benign	Het
Taar8c	A	T	10: 24,101,610	D101E	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	G	A	9: 8,653,147	M573I	probably damaging	Het
Tsr1	A	T	11: 74,899,599	D171V	probably benign	Het
Ube4b	T	C	4: 149,371,169	T348A	probably damaging	Het
Vmn1r85	A	T	7: 13,084,881	I112N	probably damaging	Het
Vps36	A	G	8: 22,218,210		probably null	Het
Wdfy3	G	A	5: 101,937,738	A630V	possibly damaging	Het
Wdsub1	A	T	2: 59,876,800	D14E	probably null	Het
Ylpm1	T	C	12: 85,030,383	I1294T	possibly damaging	Het
Zdhhc17	A	G	10: 110,955,075	F378L	probably benign	Het

Other mutations in A2m

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:A2m	APN	6	121644149	missense	possibly damaging	0.67
IGL00798:A2m	APN	6	121671010	missense	probably damaging	1.00
IGL01154:A2m	APN	6	121673542	nonsense	probably null
IGL01313:A2m	APN	6	121645010	critical splice donor site	probably null
IGL01337:A2m	APN	6	121668570	missense	probably damaging	0.98
IGL01505:A2m	APN	6	121676947	missense	possibly damaging	0.83
IGL01508:A2m	APN	6	121659367	nonsense	probably null
IGL01672:A2m	APN	6	121641357	missense	probably damaging	1.00
IGL01951:A2m	APN	6	121667190	missense	possibly damaging	0.78
IGL02012:A2m	APN	6	121674861	missense	probably damaging	1.00
IGL02066:A2m	APN	6	121649895	missense	probably damaging	1.00
IGL02234:A2m	APN	6	121668220	missense	possibly damaging	0.67
IGL02397:A2m	APN	6	121646875	missense	probably benign
IGL02407:A2m	APN	6	121668616	nonsense	probably null
IGL02408:A2m	APN	6	121644171	missense	probably damaging	0.99
IGL02469:A2m	APN	6	121668115	missense	probably damaging	1.00
IGL02527:A2m	APN	6	121661433	missense	probably damaging	0.99
IGL02612:A2m	APN	6	121678012	missense	probably benign
IGL02746:A2m	APN	6	121669503	splice site	probably benign
IGL02952:A2m	APN	6	121678025	missense	probably damaging	0.99
IGL03056:A2m	APN	6	121670903	missense	probably damaging	0.96
IGL03121:A2m	APN	6	121641306	missense	probably benign	0.02
IGL03303:A2m	APN	6	121667163	missense	probably damaging	1.00
IGL03369:A2m	APN	6	121676903	critical splice acceptor site	probably null
IGL03046:A2m	UTSW	6	121659323	missense	probably benign	0.04
R0040:A2m	UTSW	6	121645206	missense	possibly damaging	0.93
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0049:A2m	UTSW	6	121638308	missense	possibly damaging	0.77
R0109:A2m	UTSW	6	121659303	missense	probably benign	0.00
R0147:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0148:A2m	UTSW	6	121662446	critical splice donor site	probably null
R0345:A2m	UTSW	6	121638272	splice site	probably benign
R0445:A2m	UTSW	6	121657955	missense	probably damaging	1.00
R0766:A2m	UTSW	6	121676890	splice site	probably benign
R1186:A2m	UTSW	6	121661534	missense	probably benign	0.00
R1436:A2m	UTSW	6	121644213	missense	probably benign	0.09
R1636:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1637:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1638:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1698:A2m	UTSW	6	121645158	missense	possibly damaging	0.88
R1776:A2m	UTSW	6	121641424	missense	probably damaging	1.00
R1791:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1918:A2m	UTSW	6	121644936	missense	probably benign	0.16
R1921:A2m	UTSW	6	121654612	missense	probably benign	0.04
R1927:A2m	UTSW	6	121636379	missense	probably damaging	1.00
R1934:A2m	UTSW	6	121649833	missense	probably damaging	0.98
R1943:A2m	UTSW	6	121668547	missense	possibly damaging	0.90
R1996:A2m	UTSW	6	121669597	missense	probably damaging	1.00
R2039:A2m	UTSW	6	121659949	missense	probably benign	0.32
R2085:A2m	UTSW	6	121676959	missense	probably damaging	1.00
R2092:A2m	UTSW	6	121674937	nonsense	probably null
R2105:A2m	UTSW	6	121673500	missense	probably benign	0.04
R2107:A2m	UTSW	6	121654612	missense	probably benign	0.04
R2235:A2m	UTSW	6	121642064	missense	probably benign	0.21
R2292:A2m	UTSW	6	121673559	missense	possibly damaging	0.90
R2350:A2m	UTSW	6	121678088	splice site	probably benign
R3001:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3002:A2m	UTSW	6	121661447	missense	possibly damaging	0.88
R3023:A2m	UTSW	6	121669572	missense	probably benign	0.08
R3429:A2m	UTSW	6	121636290	start codon destroyed	probably null
R3437:A2m	UTSW	6	121639294	missense	probably null	0.03
R3909:A2m	UTSW	6	121648166	missense	probably damaging	1.00
R4300:A2m	UTSW	6	121673475	missense	probably benign	0.00
R4332:A2m	UTSW	6	121657447	missense	probably benign	0.01
R4584:A2m	UTSW	6	121657406	missense	probably benign	0.07
R4697:A2m	UTSW	6	121638284	start codon destroyed	probably null	0.94
R4710:A2m	UTSW	6	121641303	missense	probably benign	0.03
R4841:A2m	UTSW	6	121646844	missense	probably benign	0.06
R5206:A2m	UTSW	6	121674807	missense	probably damaging	1.00
R5219:A2m	UTSW	6	121676950	missense	possibly damaging	0.90
R5230:A2m	UTSW	6	121674861	missense	probably damaging	1.00
R5330:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5331:A2m	UTSW	6	121638416	missense	probably benign	0.11
R5377:A2m	UTSW	6	121645253	missense	probably benign
R5590:A2m	UTSW	6	121676932	missense	probably damaging	1.00
R5835:A2m	UTSW	6	121639336	missense	probably damaging	1.00
R5910:A2m	UTSW	6	121668117	missense	probably damaging	1.00
R5915:A2m	UTSW	6	121667163	missense	probably damaging	1.00
R5949:A2m	UTSW	6	121678073	missense	probably damaging	1.00
R5994:A2m	UTSW	6	121670903	missense	probably benign	0.38
R5996:A2m	UTSW	6	121659394	missense	probably damaging	1.00
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6035:A2m	UTSW	6	121638394	missense	probably damaging	0.99
R6090:A2m	UTSW	6	121648013	missense	probably benign	0.45
R6241:A2m	UTSW	6	121646829	missense	probably benign	0.09
R6294:A2m	UTSW	6	121654481	missense	probably benign
R6492:A2m	UTSW	6	121654505	missense	probably benign	0.35
R6554:A2m	UTSW	6	121641287	missense	probably damaging	1.00
R6597:A2m	UTSW	6	121648121	missense	probably damaging	1.00
R6742:A2m	UTSW	6	121678036	missense	probably benign	0.01
R6795:A2m	UTSW	6	121648322	intron	probably null
R6843:A2m	UTSW	6	121638401	missense	probably benign	0.01
R7013:A2m	UTSW	6	121641386	missense	probably null	0.00
R7137:A2m	UTSW	6	121677985	missense	possibly damaging	0.85
R7167:A2m	UTSW	6	121647971	missense	probably benign
R7294:A2m	UTSW	6	121673582	nonsense	probably null
R7452:A2m	UTSW	6	121641332	missense	probably damaging	1.00
R7507:A2m	UTSW	6	121675218	missense	probably benign	0.01
R7602:A2m	UTSW	6	121642007	missense	probably damaging	1.00
R7602:A2m	UTSW	6	121670936	missense	possibly damaging	0.79
R7709:A2m	UTSW	6	121660104	missense	possibly damaging	0.81
R7766:A2m	UTSW	6	121638341	missense	probably benign	0.08
X0057:A2m	UTSW	6	121668176	missense	probably damaging	1.00
X0060:A2m	UTSW	6	121676080	missense	probably damaging	1.00
X0063:A2m	UTSW	6	121646876	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAATAGTTCCCAACCTGTGTTCCC -3'
(R):5'- ATGGTGAGCCACATTTCACCCC -3'

Sequencing Primer
(F):5'- caacctgtgttccctttgtg -3'
(R):5'- GTGCTTTCTTCCACAGAAGCAAG -3'

Posted On

2014-03-14