Incidental Mutation 'R1452:Slco1b2'
ID 161069
Institutional Source Beutler Lab
Gene Symbol Slco1b2
Ensembl Gene ENSMUSG00000030236
Gene Name solute carrier organic anion transporter family, member 1b2
Synonyms 7330442B20Rik, Slc21a6, mlst-1, Oatp1b2, Slc21a10
MMRRC Submission 039507-MU
Accession Numbers

Genbank: NM_020495; MGI: 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1452 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 141629518-141686646 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141672200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 424 (I424F)
Ref Sequence ENSEMBL: ENSMUSP00000144747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042812] [ENSMUST00000203597]
AlphaFold Q9JJL3
Predicted Effect probably benign
Transcript: ENSMUST00000042812
AA Change: I459F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000044326
Gene: ENSMUSG00000030236
AA Change: I459F

Pfam:MFS_1 27 443 6.1e-21 PFAM
KAZAL 457 501 8.81e-4 SMART
transmembrane domain 620 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203597
AA Change: I424F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000144747
Gene: ENSMUSG00000030236
AA Change: I424F

Pfam:MFS_1 27 405 8.4e-19 PFAM
KAZAL 422 466 5.7e-6 SMART
transmembrane domain 497 519 N/A INTRINSIC
transmembrane domain 534 556 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a liver-specific member of the organic anion transporter family. The encoded protein is a transmembrane receptor that mediates the sodium-independent uptake of endogenous and xenobiotic compounds and plays a critical role in bile acid and bilirubin transport. Mutations in this gene are a cause of Rotor type hyperbilirubinemia. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null mutation display slight abnormalities in blood chemistry and are resistant to injury induced by some classes of hepatotoxins. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,939 Y415C probably damaging Het
2810474O19Rik A T 6: 149,326,632 K392I probably damaging Het
A2m A G 6: 121,678,056 I1446M probably benign Het
Acaca T A 11: 84,295,059 probably benign Het
Adgre4 A T 17: 55,784,996 E85D probably benign Het
Akt3 A T 1: 177,131,067 Y26N possibly damaging Het
Arl15 T C 13: 113,967,783 V132A probably benign Het
Atp6v1h A G 1: 5,098,137 probably benign Het
Atrip T A 9: 109,072,659 D110V probably damaging Het
Bahcc1 T G 11: 120,282,239 probably benign Het
Cd53 C T 3: 106,768,959 G31S probably damaging Het
Cdk14 T C 5: 4,888,927 S404G possibly damaging Het
Cers3 A T 7: 66,783,404 K156N probably damaging Het
Colgalt2 C A 1: 152,504,153 L448M probably damaging Het
Cox15 G T 19: 43,746,905 T141K probably damaging Het
Csnk2a2 C T 8: 95,457,375 probably benign Het
Cyp2b10 A T 7: 25,925,388 probably benign Het
Cyp2c55 A G 19: 39,011,090 Y80C probably damaging Het
Depdc1a A G 3: 159,526,691 Y693C possibly damaging Het
Des T C 1: 75,363,477 S343P probably damaging Het
Dync1i2 T C 2: 71,249,863 probably benign Het
Eif3m T A 2: 105,006,777 Q199L probably damaging Het
Emsy G T 7: 98,600,674 T802K probably damaging Het
Endov A G 11: 119,491,825 T33A probably damaging Het
Epb41l5 G A 1: 119,549,166 T728I probably damaging Het
Fbxo39 A G 11: 72,318,402 I363V probably benign Het
Gm8674 C T 13: 49,900,517 noncoding transcript Het
Gm9733 G T 3: 15,332,152 T24K unknown Het
Il6st T A 13: 112,481,464 N137K possibly damaging Het
Inf2 A G 12: 112,601,344 N136S probably damaging Het
Iqub A T 6: 24,491,559 I376N probably benign Het
Kansl3 A G 1: 36,354,793 probably benign Het
Kbtbd2 A T 6: 56,781,924 H71Q probably damaging Het
Lgals8 G T 13: 12,453,327 Y140* probably null Het
Macf1 T A 4: 123,493,998 I924L probably benign Het
Mcoln2 A T 3: 146,181,814 T329S possibly damaging Het
Mex3d A T 10: 80,381,520 L621Q probably damaging Het
Mut A G 17: 40,937,468 probably benign Het
Ncor1 T C 11: 62,334,631 H1038R probably damaging Het
Neb A G 2: 52,271,297 probably null Het
Ngrn A G 7: 80,264,772 T224A probably benign Het
Nin G A 12: 70,017,650 R2019* probably null Het
Nphp4 C G 4: 152,547,018 Q792E probably damaging Het
Olfr1047 T A 2: 86,228,455 N172I probably damaging Het
Olfr1166 C T 2: 88,124,311 V225I probably benign Het
Olfr140 C T 2: 90,051,671 V218I possibly damaging Het
Olfr373 C T 8: 72,100,176 Q139* probably null Het
Olfr70 C T 4: 43,696,823 V117M probably benign Het
Pde4dip C A 3: 97,724,102 V1164L probably damaging Het
Plppr1 A G 4: 49,301,067 probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Ppp2r5e A G 12: 75,469,536 probably benign Het
Prim2 T A 1: 33,630,404 E163D probably benign Het
Prrc2b A T 2: 32,194,985 D296V probably damaging Het
Pter A G 2: 12,978,621 probably benign Het
Robo2 C A 16: 73,961,910 V662L probably damaging Het
Snx29 A T 16: 11,631,471 H260L probably damaging Het
Stil A G 4: 115,039,195 N959S probably benign Het
Taar8c A T 10: 24,101,610 D101E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 G A 9: 8,653,147 M573I probably damaging Het
Tsr1 A T 11: 74,899,599 D171V probably benign Het
Ube4b T C 4: 149,371,169 T348A probably damaging Het
Vmn1r85 A T 7: 13,084,881 I112N probably damaging Het
Vps36 A G 8: 22,218,210 probably null Het
Wdfy3 G A 5: 101,937,738 A630V possibly damaging Het
Wdsub1 A T 2: 59,876,800 D14E probably null Het
Ylpm1 T C 12: 85,030,383 I1294T possibly damaging Het
Zdhhc17 A G 10: 110,955,075 F378L probably benign Het
Other mutations in Slco1b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Slco1b2 APN 6 141655352 missense probably damaging 0.99
IGL01583:Slco1b2 APN 6 141663672 missense possibly damaging 0.85
IGL01909:Slco1b2 APN 6 141648586 missense probably damaging 1.00
IGL01943:Slco1b2 APN 6 141676286 missense possibly damaging 0.71
IGL01952:Slco1b2 APN 6 141671230 missense probably benign 0.01
IGL02186:Slco1b2 APN 6 141634545 splice site probably benign
IGL02309:Slco1b2 APN 6 141672281 missense probably damaging 1.00
IGL02352:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02359:Slco1b2 APN 6 141685525 missense probably damaging 0.96
IGL02524:Slco1b2 APN 6 141671072 missense probably benign 0.03
IGL02701:Slco1b2 APN 6 141685545 missense probably benign 0.35
IGL02962:Slco1b2 APN 6 141648553 missense probably damaging 0.99
3-1:Slco1b2 UTSW 6 141669463 missense probably benign 0.01
IGL03052:Slco1b2 UTSW 6 141648585 missense probably benign 0.13
R0112:Slco1b2 UTSW 6 141671111 missense probably benign 0.30
R0116:Slco1b2 UTSW 6 141669388 missense probably benign 0.22
R0515:Slco1b2 UTSW 6 141669410 missense possibly damaging 0.74
R0831:Slco1b2 UTSW 6 141685446 missense probably benign 0.01
R0965:Slco1b2 UTSW 6 141685596 missense probably damaging 1.00
R1115:Slco1b2 UTSW 6 141683254 missense probably benign 0.03
R1630:Slco1b2 UTSW 6 141656821 missense probably damaging 0.99
R1885:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1886:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R1975:Slco1b2 UTSW 6 141683225 missense probably damaging 0.96
R2394:Slco1b2 UTSW 6 141669374 missense probably damaging 0.99
R3408:Slco1b2 UTSW 6 141676256 missense probably benign 0.01
R3793:Slco1b2 UTSW 6 141676307 missense probably damaging 1.00
R4560:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4561:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4563:Slco1b2 UTSW 6 141671167 missense probably benign 0.15
R4807:Slco1b2 UTSW 6 141669469 missense probably damaging 1.00
R4820:Slco1b2 UTSW 6 141685432 missense probably benign 0.05
R4861:Slco1b2 UTSW 6 141671222 missense possibly damaging 0.95
R4861:Slco1b2 UTSW 6 141671222 missense possibly damaging 0.95
R4889:Slco1b2 UTSW 6 141656743 intron probably benign
R4914:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4918:Slco1b2 UTSW 6 141669370 missense probably benign 0.14
R4977:Slco1b2 UTSW 6 141657557 missense probably benign 0.01
R5607:Slco1b2 UTSW 6 141685586 missense probably benign
R6082:Slco1b2 UTSW 6 141663670 missense probably benign 0.08
R6118:Slco1b2 UTSW 6 141657510 missense probably benign 0.03
R6522:Slco1b2 UTSW 6 141655419 critical splice donor site probably null
R7054:Slco1b2 UTSW 6 141672248 missense probably damaging 1.00
R7182:Slco1b2 UTSW 6 141656930 missense probably damaging 1.00
R7763:Slco1b2 UTSW 6 141676224 nonsense probably null
R8891:Slco1b2 UTSW 6 141683267 missense probably benign 0.34
R8977:Slco1b2 UTSW 6 141683254 missense probably benign
R9012:Slco1b2 UTSW 6 141656828 missense probably damaging 1.00
R9106:Slco1b2 UTSW 6 141672248 missense probably damaging 1.00
R9176:Slco1b2 UTSW 6 141652503 missense probably damaging 1.00
R9366:Slco1b2 UTSW 6 141656826 nonsense probably null
R9425:Slco1b2 UTSW 6 141657523 missense possibly damaging 0.67
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ttcttttctctttcctttccttctg -3'
Posted On 2014-03-14