Incidental Mutation 'R1452:Vps36'
Institutional Source Beutler Lab
Gene Symbol Vps36
Ensembl Gene ENSMUSG00000031479
Gene Namevacuolar protein sorting 36
SynonymsEap45, 2810408E15Rik, 1700010A24Rik, 2210415M20Rik
MMRRC Submission 039507-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1452 (G1)
Quality Score225
Status Validated
Chromosomal Location22192809-22220843 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 22218210 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033866]
PDB Structure The complex structure between the mouse EAP45-GLUE domain and ubiquitin [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000033866
SMART Domains Protein: ENSMUSP00000033866
Gene: ENSMUSG00000031479

Pfam:Vps36_ESCRT-II 2 88 1e-19 PFAM
Pfam:EAP30 154 369 1.4e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153949
Meta Mutation Damage Score 0.9477 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a subunit of the endosomal sorting complex required for transport II (ESCRT-II). This protein complex functions in sorting of ubiquitinated membrane proteins during endocytosis. A similar protein complex in rat is associated with RNA polymerase elongation factor II. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,939 Y415C probably damaging Het
2810474O19Rik A T 6: 149,326,632 K392I probably damaging Het
A2m A G 6: 121,678,056 I1446M probably benign Het
Acaca T A 11: 84,295,059 probably benign Het
Adgre4 A T 17: 55,784,996 E85D probably benign Het
Akt3 A T 1: 177,131,067 Y26N possibly damaging Het
Arl15 T C 13: 113,967,783 V132A probably benign Het
Atp6v1h A G 1: 5,098,137 probably benign Het
Atrip T A 9: 109,072,659 D110V probably damaging Het
Bahcc1 T G 11: 120,282,239 probably benign Het
Cd53 C T 3: 106,768,959 G31S probably damaging Het
Cdk14 T C 5: 4,888,927 S404G possibly damaging Het
Cers3 A T 7: 66,783,404 K156N probably damaging Het
Colgalt2 C A 1: 152,504,153 L448M probably damaging Het
Cox15 G T 19: 43,746,905 T141K probably damaging Het
Csnk2a2 C T 8: 95,457,375 probably benign Het
Cyp2b10 A T 7: 25,925,388 probably benign Het
Cyp2c55 A G 19: 39,011,090 Y80C probably damaging Het
Depdc1a A G 3: 159,526,691 Y693C possibly damaging Het
Des T C 1: 75,363,477 S343P probably damaging Het
Dync1i2 T C 2: 71,249,863 probably benign Het
Eif3m T A 2: 105,006,777 Q199L probably damaging Het
Emsy G T 7: 98,600,674 T802K probably damaging Het
Endov A G 11: 119,491,825 T33A probably damaging Het
Epb41l5 G A 1: 119,549,166 T728I probably damaging Het
Fbxo39 A G 11: 72,318,402 I363V probably benign Het
Gm8674 C T 13: 49,900,517 noncoding transcript Het
Gm9733 G T 3: 15,332,152 T24K unknown Het
Il6st T A 13: 112,481,464 N137K possibly damaging Het
Inf2 A G 12: 112,601,344 N136S probably damaging Het
Iqub A T 6: 24,491,559 I376N probably benign Het
Kansl3 A G 1: 36,354,793 probably benign Het
Kbtbd2 A T 6: 56,781,924 H71Q probably damaging Het
Lgals8 G T 13: 12,453,327 Y140* probably null Het
Macf1 T A 4: 123,493,998 I924L probably benign Het
Mcoln2 A T 3: 146,181,814 T329S possibly damaging Het
Mex3d A T 10: 80,381,520 L621Q probably damaging Het
Mut A G 17: 40,937,468 probably benign Het
Ncor1 T C 11: 62,334,631 H1038R probably damaging Het
Neb A G 2: 52,271,297 probably null Het
Ngrn A G 7: 80,264,772 T224A probably benign Het
Nin G A 12: 70,017,650 R2019* probably null Het
Nphp4 C G 4: 152,547,018 Q792E probably damaging Het
Olfr1047 T A 2: 86,228,455 N172I probably damaging Het
Olfr1166 C T 2: 88,124,311 V225I probably benign Het
Olfr140 C T 2: 90,051,671 V218I possibly damaging Het
Olfr373 C T 8: 72,100,176 Q139* probably null Het
Olfr70 C T 4: 43,696,823 V117M probably benign Het
Pde4dip C A 3: 97,724,102 V1164L probably damaging Het
Plppr1 A G 4: 49,301,067 probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Ppp2r5e A G 12: 75,469,536 probably benign Het
Prim2 T A 1: 33,630,404 E163D probably benign Het
Prrc2b A T 2: 32,194,985 D296V probably damaging Het
Pter A G 2: 12,978,621 probably benign Het
Robo2 C A 16: 73,961,910 V662L probably damaging Het
Slco1b2 A T 6: 141,672,200 I424F probably benign Het
Snx29 A T 16: 11,631,471 H260L probably damaging Het
Stil A G 4: 115,039,195 N959S probably benign Het
Taar8c A T 10: 24,101,610 D101E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 G A 9: 8,653,147 M573I probably damaging Het
Tsr1 A T 11: 74,899,599 D171V probably benign Het
Ube4b T C 4: 149,371,169 T348A probably damaging Het
Vmn1r85 A T 7: 13,084,881 I112N probably damaging Het
Wdfy3 G A 5: 101,937,738 A630V possibly damaging Het
Wdsub1 A T 2: 59,876,800 D14E probably null Het
Ylpm1 T C 12: 85,030,383 I1294T possibly damaging Het
Zdhhc17 A G 10: 110,955,075 F378L probably benign Het
Other mutations in Vps36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02577:Vps36 APN 8 22211616 nonsense probably null
IGL03035:Vps36 APN 8 22218415 missense probably benign 0.10
R0270:Vps36 UTSW 8 22210456 missense possibly damaging 0.85
R0532:Vps36 UTSW 8 22218245 missense probably benign 0.03
R0966:Vps36 UTSW 8 22206817 nonsense probably null
R1880:Vps36 UTSW 8 22213562 critical splice donor site probably null
R2127:Vps36 UTSW 8 22218289 critical splice donor site probably null
R2128:Vps36 UTSW 8 22218289 critical splice donor site probably null
R3708:Vps36 UTSW 8 22192883 missense probably benign
R4583:Vps36 UTSW 8 22218420 missense probably benign 0.22
R4917:Vps36 UTSW 8 22218264 missense possibly damaging 0.93
R6354:Vps36 UTSW 8 22205755 missense probably damaging 1.00
R6597:Vps36 UTSW 8 22202304 missense probably benign
R7207:Vps36 UTSW 8 22211607 missense probably benign 0.28
R8251:Vps36 UTSW 8 22192916 missense probably benign 0.01
Z1177:Vps36 UTSW 8 22192830 start gained probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- acttcacaaccatccataccc -3'
Posted On2014-03-14