Incidental Mutation 'R1452:Atrip'
ID161080
Institutional Source Beutler Lab
Gene Symbol Atrip
Ensembl Gene ENSMUSG00000025646
Gene NameATR interacting protein
Synonyms
MMRRC Submission 039507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1452 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location109057933-109074124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109072659 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 110 (D110V)
Ref Sequence ENSEMBL: ENSMUSP00000125264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045011] [ENSMUST00000160217] [ENSMUST00000161521] [ENSMUST00000192801]
Predicted Effect probably damaging
Transcript: ENSMUST00000045011
AA Change: D110V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044831
Gene: ENSMUSG00000025646
AA Change: D110V

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 8e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 761 779 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160217
AA Change: D110V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125264
Gene: ENSMUSG00000025646
AA Change: D110V

DomainStartEndE-ValueType
SCOP:d1eq1a_ 96 193 3e-3 SMART
low complexity region 326 338 N/A INTRINSIC
low complexity region 533 550 N/A INTRINSIC
low complexity region 570 581 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160928
SMART Domains Protein: ENSMUSP00000123837
Gene: ENSMUSG00000025646

DomainStartEndE-ValueType
SCOP:d1eq1a_ 19 116 9e-3 SMART
low complexity region 249 261 N/A INTRINSIC
low complexity region 465 471 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 521 532 N/A INTRINSIC
low complexity region 684 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161270
Predicted Effect probably damaging
Transcript: ENSMUST00000161521
AA Change: D110V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125615
Gene: ENSMUSG00000025646
AA Change: D110V

DomainStartEndE-ValueType
coiled coil region 108 208 N/A INTRINSIC
low complexity region 326 338 N/A INTRINSIC
low complexity region 542 548 N/A INTRINSIC
low complexity region 555 566 N/A INTRINSIC
low complexity region 598 609 N/A INTRINSIC
low complexity region 734 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194199
Meta Mutation Damage Score 0.3556 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential component of the DNA damage checkpoint. The encoded protein binds to single-stranded DNA coated with replication protein A. The protein also interacts with the ataxia telangiectasia and Rad3 related protein kinase, resulting in its accumulation at intranuclear foci induced by DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,939 Y415C probably damaging Het
2810474O19Rik A T 6: 149,326,632 K392I probably damaging Het
A2m A G 6: 121,678,056 I1446M probably benign Het
Acaca T A 11: 84,295,059 probably benign Het
Adgre4 A T 17: 55,784,996 E85D probably benign Het
Akt3 A T 1: 177,131,067 Y26N possibly damaging Het
Arl15 T C 13: 113,967,783 V132A probably benign Het
Atp6v1h A G 1: 5,098,137 probably benign Het
Bahcc1 T G 11: 120,282,239 probably benign Het
Cd53 C T 3: 106,768,959 G31S probably damaging Het
Cdk14 T C 5: 4,888,927 S404G possibly damaging Het
Cers3 A T 7: 66,783,404 K156N probably damaging Het
Colgalt2 C A 1: 152,504,153 L448M probably damaging Het
Cox15 G T 19: 43,746,905 T141K probably damaging Het
Csnk2a2 C T 8: 95,457,375 probably benign Het
Cyp2b10 A T 7: 25,925,388 probably benign Het
Cyp2c55 A G 19: 39,011,090 Y80C probably damaging Het
Depdc1a A G 3: 159,526,691 Y693C possibly damaging Het
Des T C 1: 75,363,477 S343P probably damaging Het
Dync1i2 T C 2: 71,249,863 probably benign Het
Eif3m T A 2: 105,006,777 Q199L probably damaging Het
Emsy G T 7: 98,600,674 T802K probably damaging Het
Endov A G 11: 119,491,825 T33A probably damaging Het
Epb41l5 G A 1: 119,549,166 T728I probably damaging Het
Fbxo39 A G 11: 72,318,402 I363V probably benign Het
Gm8674 C T 13: 49,900,517 noncoding transcript Het
Gm9733 G T 3: 15,332,152 T24K unknown Het
Il6st T A 13: 112,481,464 N137K possibly damaging Het
Inf2 A G 12: 112,601,344 N136S probably damaging Het
Iqub A T 6: 24,491,559 I376N probably benign Het
Kansl3 A G 1: 36,354,793 probably benign Het
Kbtbd2 A T 6: 56,781,924 H71Q probably damaging Het
Lgals8 G T 13: 12,453,327 Y140* probably null Het
Macf1 T A 4: 123,493,998 I924L probably benign Het
Mcoln2 A T 3: 146,181,814 T329S possibly damaging Het
Mex3d A T 10: 80,381,520 L621Q probably damaging Het
Mut A G 17: 40,937,468 probably benign Het
Ncor1 T C 11: 62,334,631 H1038R probably damaging Het
Neb A G 2: 52,271,297 probably null Het
Ngrn A G 7: 80,264,772 T224A probably benign Het
Nin G A 12: 70,017,650 R2019* probably null Het
Nphp4 C G 4: 152,547,018 Q792E probably damaging Het
Olfr1047 T A 2: 86,228,455 N172I probably damaging Het
Olfr1166 C T 2: 88,124,311 V225I probably benign Het
Olfr140 C T 2: 90,051,671 V218I possibly damaging Het
Olfr373 C T 8: 72,100,176 Q139* probably null Het
Olfr70 C T 4: 43,696,823 V117M probably benign Het
Pde4dip C A 3: 97,724,102 V1164L probably damaging Het
Plppr1 A G 4: 49,301,067 probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Ppp2r5e A G 12: 75,469,536 probably benign Het
Prim2 T A 1: 33,630,404 E163D probably benign Het
Prrc2b A T 2: 32,194,985 D296V probably damaging Het
Pter A G 2: 12,978,621 probably benign Het
Robo2 C A 16: 73,961,910 V662L probably damaging Het
Slco1b2 A T 6: 141,672,200 I424F probably benign Het
Snx29 A T 16: 11,631,471 H260L probably damaging Het
Stil A G 4: 115,039,195 N959S probably benign Het
Taar8c A T 10: 24,101,610 D101E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 G A 9: 8,653,147 M573I probably damaging Het
Tsr1 A T 11: 74,899,599 D171V probably benign Het
Ube4b T C 4: 149,371,169 T348A probably damaging Het
Vmn1r85 A T 7: 13,084,881 I112N probably damaging Het
Vps36 A G 8: 22,218,210 probably null Het
Wdfy3 G A 5: 101,937,738 A630V possibly damaging Het
Wdsub1 A T 2: 59,876,800 D14E probably null Het
Ylpm1 T C 12: 85,030,383 I1294T possibly damaging Het
Zdhhc17 A G 10: 110,955,075 F378L probably benign Het
Other mutations in Atrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Atrip APN 9 109069295 missense probably damaging 1.00
IGL02176:Atrip APN 9 109067046 missense probably benign 0.06
IGL02227:Atrip APN 9 109061664 missense possibly damaging 0.86
IGL02344:Atrip APN 9 109072624 nonsense probably null
IGL02406:Atrip APN 9 109065419 missense probably damaging 0.99
IGL02457:Atrip APN 9 109065231 missense possibly damaging 0.95
IGL02823:Atrip APN 9 109061178 missense probably damaging 1.00
PIT4508001:Atrip UTSW 9 109073989 missense possibly damaging 0.93
R0637:Atrip UTSW 9 109061173 missense possibly damaging 0.58
R0709:Atrip UTSW 9 109067103 missense probably benign 0.00
R1944:Atrip UTSW 9 109071867 missense probably damaging 1.00
R1945:Atrip UTSW 9 109071867 missense probably damaging 1.00
R2081:Atrip UTSW 9 109072739 critical splice acceptor site probably null
R4588:Atrip UTSW 9 109060279 missense probably damaging 1.00
R5032:Atrip UTSW 9 109065203 missense probably benign 0.02
R5088:Atrip UTSW 9 109059896 missense probably damaging 0.97
R5696:Atrip UTSW 9 109065501 missense possibly damaging 0.59
R6104:Atrip UTSW 9 109065564 missense possibly damaging 0.94
R6136:Atrip UTSW 9 109071736 missense probably damaging 1.00
R7071:Atrip UTSW 9 109067014 splice site probably null
R7131:Atrip UTSW 9 109060420 missense probably benign
R7467:Atrip UTSW 9 109069354 missense probably damaging 1.00
R7734:Atrip UTSW 9 109065506 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AATTTCAGGCATTCTTTCCCCAACCT -3'
(R):5'- TGGATACATACTGAGCCCCGCA -3'

Sequencing Primer
(F):5'- ggctggaaggatagcctaac -3'
(R):5'- attttttccagacaggttctcg -3'
Posted On2014-03-14