Mutagenetix > Incidental Mutations

Incidental Mutation 'R1452:Ncor1'

161084

Institutional Source

Beutler Lab

Gene Symbol

Ncor1

Ensembl Gene

ENSMUSG00000018501

Gene Name

nuclear receptor co-repressor 1

Synonyms

5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR

MMRRC Submission

039507-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1452 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

62316426-62458541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62334631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1038 (H1038R)

Ref Sequence

ENSEMBL: ENSMUSP00000122654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000155712]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000018645
AA Change: H1768R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: H1768R

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
Pfam:GPS2_interact	150	239	1.4e-37	PFAM
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037575
AA Change: H714R

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501
AA Change: H714R

Domain	Start	End	E-Value	Type
low complexity region	28	41	N/A	INTRINSIC
low complexity region	461	472	N/A	INTRINSIC
coiled coil region	658	695	N/A	INTRINSIC
low complexity region	780	794	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
PDB:3N00\|B	1010	1030	2e-7	PDB
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
PDB:2OVM\|B	1212	1235	2e-8	PDB
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101066
AA Change: H1768R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: H1768R

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101067
AA Change: H1701R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: H1701R

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	716	734	N/A	INTRINSIC
low complexity region	838	849	N/A	INTRINSIC
low complexity region	937	945	N/A	INTRINSIC
low complexity region	952	963	N/A	INTRINSIC
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1448	1459	N/A	INTRINSIC
coiled coil region	1645	1682	N/A	INTRINSIC
low complexity region	1767	1781	N/A	INTRINSIC
low complexity region	1902	1913	N/A	INTRINSIC
low complexity region	1969	1988	N/A	INTRINSIC
PDB:3N00\|B	1997	2017	4e-7	PDB
low complexity region	2019	2034	N/A	INTRINSIC
low complexity region	2089	2100	N/A	INTRINSIC
PDB:2OVM\|B	2199	2222	2e-8	PDB
low complexity region	2243	2256	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121709

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131911

Predicted Effect

probably damaging
Transcript: ENSMUST00000155712
AA Change: H1038R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: H1038R

Domain	Start	End	E-Value	Type
low complexity region	26	47	N/A	INTRINSIC
low complexity region	87	104	N/A	INTRINSIC
low complexity region	204	215	N/A	INTRINSIC
low complexity region	303	311	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	352	365	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
coiled coil region	982	1019	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC
low complexity region	1239	1250	N/A	INTRINSIC
low complexity region	1306	1325	N/A	INTRINSIC
PDB:3N00\|B	1334	1354	3e-7	PDB
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1427	1438	N/A	INTRINSIC
PDB:2OVM\|B	1537	1560	2e-8	PDB
low complexity region	1581	1594	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000156740
AA Change: H703R

SMART Domains

Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501
AA Change: H703R

Domain	Start	End	E-Value	Type
low complexity region	18	31	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
coiled coil region	647	684	N/A	INTRINSIC
low complexity region	770	784	N/A	INTRINSIC
low complexity region	905	916	N/A	INTRINSIC
low complexity region	972	991	N/A	INTRINSIC
PDB:3N00\|B	1000	1020	2e-7	PDB
low complexity region	1022	1037	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
PDB:2OVM\|B	1202	1225	2e-8	PDB
low complexity region	1246	1259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161281

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161767

Meta Mutation Damage Score

0.1130

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.8%
20x: 87.5%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,939	Y415C	probably damaging	Het
2810474O19Rik	A	T	6: 149,326,632	K392I	probably damaging	Het
A2m	A	G	6: 121,678,056	I1446M	probably benign	Het
Acaca	T	A	11: 84,295,059		probably benign	Het
Adgre4	A	T	17: 55,784,996	E85D	probably benign	Het
Akt3	A	T	1: 177,131,067	Y26N	possibly damaging	Het
Arl15	T	C	13: 113,967,783	V132A	probably benign	Het
Atp6v1h	A	G	1: 5,098,137		probably benign	Het
Atrip	T	A	9: 109,072,659	D110V	probably damaging	Het
Bahcc1	T	G	11: 120,282,239		probably benign	Het
Cd53	C	T	3: 106,768,959	G31S	probably damaging	Het
Cdk14	T	C	5: 4,888,927	S404G	possibly damaging	Het
Cers3	A	T	7: 66,783,404	K156N	probably damaging	Het
Colgalt2	C	A	1: 152,504,153	L448M	probably damaging	Het
Cox15	G	T	19: 43,746,905	T141K	probably damaging	Het
Csnk2a2	C	T	8: 95,457,375		probably benign	Het
Cyp2b10	A	T	7: 25,925,388		probably benign	Het
Cyp2c55	A	G	19: 39,011,090	Y80C	probably damaging	Het
Depdc1a	A	G	3: 159,526,691	Y693C	possibly damaging	Het
Des	T	C	1: 75,363,477	S343P	probably damaging	Het
Dync1i2	T	C	2: 71,249,863		probably benign	Het
Eif3m	T	A	2: 105,006,777	Q199L	probably damaging	Het
Emsy	G	T	7: 98,600,674	T802K	probably damaging	Het
Endov	A	G	11: 119,491,825	T33A	probably damaging	Het
Epb41l5	G	A	1: 119,549,166	T728I	probably damaging	Het
Fbxo39	A	G	11: 72,318,402	I363V	probably benign	Het
Gm8674	C	T	13: 49,900,517		noncoding transcript	Het
Gm9733	G	T	3: 15,332,152	T24K	unknown	Het
Il6st	T	A	13: 112,481,464	N137K	possibly damaging	Het
Inf2	A	G	12: 112,601,344	N136S	probably damaging	Het
Iqub	A	T	6: 24,491,559	I376N	probably benign	Het
Kansl3	A	G	1: 36,354,793		probably benign	Het
Kbtbd2	A	T	6: 56,781,924	H71Q	probably damaging	Het
Lgals8	G	T	13: 12,453,327	Y140*	probably null	Het
Macf1	T	A	4: 123,493,998	I924L	probably benign	Het
Mcoln2	A	T	3: 146,181,814	T329S	possibly damaging	Het
Mex3d	A	T	10: 80,381,520	L621Q	probably damaging	Het
Mut	A	G	17: 40,937,468		probably benign	Het
Neb	A	G	2: 52,271,297		probably null	Het
Ngrn	A	G	7: 80,264,772	T224A	probably benign	Het
Nin	G	A	12: 70,017,650	R2019*	probably null	Het
Nphp4	C	G	4: 152,547,018	Q792E	probably damaging	Het
Olfr1047	T	A	2: 86,228,455	N172I	probably damaging	Het
Olfr1166	C	T	2: 88,124,311	V225I	probably benign	Het
Olfr140	C	T	2: 90,051,671	V218I	possibly damaging	Het
Olfr373	C	T	8: 72,100,176	Q139*	probably null	Het
Olfr70	C	T	4: 43,696,823	V117M	probably benign	Het
Pde4dip	C	A	3: 97,724,102	V1164L	probably damaging	Het
Plppr1	A	G	4: 49,301,067		probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Ppp2r5e	A	G	12: 75,469,536		probably benign	Het
Prim2	T	A	1: 33,630,404	E163D	probably benign	Het
Prrc2b	A	T	2: 32,194,985	D296V	probably damaging	Het
Pter	A	G	2: 12,978,621		probably benign	Het
Robo2	C	A	16: 73,961,910	V662L	probably damaging	Het
Slco1b2	A	T	6: 141,672,200	I424F	probably benign	Het
Snx29	A	T	16: 11,631,471	H260L	probably damaging	Het
Stil	A	G	4: 115,039,195	N959S	probably benign	Het
Taar8c	A	T	10: 24,101,610	D101E	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	G	A	9: 8,653,147	M573I	probably damaging	Het
Tsr1	A	T	11: 74,899,599	D171V	probably benign	Het
Ube4b	T	C	4: 149,371,169	T348A	probably damaging	Het
Vmn1r85	A	T	7: 13,084,881	I112N	probably damaging	Het
Vps36	A	G	8: 22,218,210		probably null	Het
Wdfy3	G	A	5: 101,937,738	A630V	possibly damaging	Het
Wdsub1	A	T	2: 59,876,800	D14E	probably null	Het
Ylpm1	T	C	12: 85,030,383	I1294T	possibly damaging	Het
Zdhhc17	A	G	10: 110,955,075	F378L	probably benign	Het

Other mutations in Ncor1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Ncor1	APN	11	62392528	missense	probably damaging	1.00
IGL01343:Ncor1	APN	11	62325486	critical splice donor site	probably null
IGL01392:Ncor1	APN	11	62340594	missense	probably damaging	0.99
IGL01402:Ncor1	APN	11	62340474	missense	probably damaging	1.00
IGL01714:Ncor1	APN	11	62334584	missense	possibly damaging	0.58
IGL01772:Ncor1	APN	11	62349347	intron	probably benign
IGL01889:Ncor1	APN	11	62334601	missense	possibly damaging	0.69
IGL02058:Ncor1	APN	11	62344637	missense	probably damaging	1.00
IGL02065:Ncor1	APN	11	62419609	missense	possibly damaging	0.95
IGL02073:Ncor1	APN	11	62358917	missense	probably damaging	0.99
IGL02176:Ncor1	APN	11	62329659	unclassified	probably benign
IGL02288:Ncor1	APN	11	62349403	missense	probably benign	0.01
IGL02348:Ncor1	APN	11	62333659	splice site	probably benign
IGL02608:Ncor1	APN	11	62373214	missense	probably benign	0.07
laggard	UTSW	11	62369304	missense	probably damaging	1.00
Shortstep	UTSW	11	62334541	missense	probably damaging	1.00
LCD18:Ncor1	UTSW	11	62419782	critical splice acceptor site	probably benign
PIT4382001:Ncor1	UTSW	11	62344663	missense	probably damaging	0.96
PIT4576001:Ncor1	UTSW	11	62333717	missense	probably damaging	0.99
R0026:Ncor1	UTSW	11	62438429	missense	probably damaging	1.00
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0144:Ncor1	UTSW	11	62392595	missense	probably damaging	1.00
R0427:Ncor1	UTSW	11	62410920	missense	probably damaging	1.00
R0501:Ncor1	UTSW	11	62373322	missense	possibly damaging	0.73
R0544:Ncor1	UTSW	11	62333776	missense	probably damaging	1.00
R0544:Ncor1	UTSW	11	62333777	missense	probably damaging	1.00
R0563:Ncor1	UTSW	11	62343230	missense	probably damaging	0.97
R1074:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R1266:Ncor1	UTSW	11	62334040	missense	probably damaging	0.98
R1444:Ncor1	UTSW	11	62403806	missense	probably damaging	1.00
R1534:Ncor1	UTSW	11	62378504	missense	possibly damaging	0.92
R1710:Ncor1	UTSW	11	62423005	missense	probably damaging	1.00
R1762:Ncor1	UTSW	11	62384784	missense	possibly damaging	0.82
R1771:Ncor1	UTSW	11	62327112	missense	probably damaging	1.00
R1864:Ncor1	UTSW	11	62381419	missense	probably damaging	1.00
R1902:Ncor1	UTSW	11	62338158	missense	probably damaging	1.00
R1906:Ncor1	UTSW	11	62349385	missense	possibly damaging	0.81
R2009:Ncor1	UTSW	11	62325601	missense	probably benign	0.43
R3708:Ncor1	UTSW	11	62344687	missense	probably damaging	1.00
R3825:Ncor1	UTSW	11	62373357	missense	probably benign	0.00
R3923:Ncor1	UTSW	11	62325616	missense	probably damaging	1.00
R3966:Ncor1	UTSW	11	62344757	missense	probably damaging	1.00
R4049:Ncor1	UTSW	11	62329668	splice site	probably null
R4350:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4351:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4359:Ncor1	UTSW	11	62358910	missense	probably damaging	1.00
R4712:Ncor1	UTSW	11	62344834	missense	probably damaging	1.00
R4723:Ncor1	UTSW	11	62378612	missense	probably benign	0.26
R4863:Ncor1	UTSW	11	62392638	missense	possibly damaging	0.92
R4875:Ncor1	UTSW	11	62433611	small deletion	probably benign
R4956:Ncor1	UTSW	11	62340605	missense	probably damaging	1.00
R4993:Ncor1	UTSW	11	62343341	missense	probably damaging	1.00
R5079:Ncor1	UTSW	11	62345237	missense	possibly damaging	0.92
R5144:Ncor1	UTSW	11	62349464	missense	probably damaging	1.00
R5223:Ncor1	UTSW	11	62339000	missense	probably damaging	1.00
R5243:Ncor1	UTSW	11	62338962	missense	probably damaging	1.00
R5271:Ncor1	UTSW	11	62340545	missense	probably damaging	1.00
R5285:Ncor1	UTSW	11	62392649	missense	probably damaging	1.00
R5533:Ncor1	UTSW	11	62343011	missense	probably benign	0.00
R5580:Ncor1	UTSW	11	62389778	nonsense	probably null
R5593:Ncor1	UTSW	11	62369304	missense	probably damaging	1.00
R5609:Ncor1	UTSW	11	62358853	splice site	probably null
R5632:Ncor1	UTSW	11	62338234	missense	possibly damaging	0.85
R5830:Ncor1	UTSW	11	62344763	missense	possibly damaging	0.71
R5896:Ncor1	UTSW	11	62383190	missense	probably damaging	1.00
R5973:Ncor1	UTSW	11	62349310	splice site	probably null
R6013:Ncor1	UTSW	11	62321077	missense	probably benign
R6019:Ncor1	UTSW	11	62373161	missense	probably benign	0.00
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6075:Ncor1	UTSW	11	62317849	missense	probably damaging	1.00
R6091:Ncor1	UTSW	11	62419617	missense	probably damaging	0.98
R6248:Ncor1	UTSW	11	62366982	missense	probably damaging	1.00
R6281:Ncor1	UTSW	11	62373545	missense	possibly damaging	0.71
R6351:Ncor1	UTSW	11	62373298	missense	probably benign	0.30
R6469:Ncor1	UTSW	11	62343302	missense	probably damaging	1.00
R6502:Ncor1	UTSW	11	62381414	nonsense	probably null
R6614:Ncor1	UTSW	11	62330819	missense	probably benign	0.01
R6650:Ncor1	UTSW	11	62334541	missense	probably damaging	1.00
R6765:Ncor1	UTSW	11	62373446	missense	probably benign	0.01
R6852:Ncor1	UTSW	11	62343245	missense	probably damaging	0.97
R6909:Ncor1	UTSW	11	62329486	missense	probably damaging	1.00
R6965:Ncor1	UTSW	11	62353233	critical splice donor site	probably null
R7054:Ncor1	UTSW	11	62384793	missense	probably null
R7248:Ncor1	UTSW	11	62384772	missense	possibly damaging	0.89
R7352:Ncor1	UTSW	11	62333911	missense	probably damaging	0.99
R7396:Ncor1	UTSW	11	62343218	missense	probably damaging	0.99
R7434:Ncor1	UTSW	11	62383199	missense	probably damaging	0.99
R7552:Ncor1	UTSW	11	62373424	missense	possibly damaging	0.53
R7565:Ncor1	UTSW	11	62401265	missense	probably damaging	1.00
R7575:Ncor1	UTSW	11	62383256	missense	probably benign	0.21
R7622:Ncor1	UTSW	11	62317968	missense	probably benign	0.00
R7664:Ncor1	UTSW	11	62398328	missense	probably damaging	1.00
R7814:Ncor1	UTSW	11	62333926	missense	probably damaging	0.99
R7963:Ncor1	UTSW	11	62334533	missense	probably benign	0.28
R7990:Ncor1	UTSW	11	62349495	critical splice acceptor site	probably null
R8302:Ncor1	UTSW	11	62333855	missense	probably benign	0.00
R8334:Ncor1	UTSW	11	62383244	missense	probably damaging	0.99
R8512:Ncor1	UTSW	11	62433611	small deletion	probably benign
R8728:Ncor1	UTSW	11	62330859	missense	probably benign	0.04
R8777:Ncor1	UTSW	11	62433666	missense	probably benign	0.03
R8777:Ncor1	UTSW	11	62433668	missense	probably damaging	1.00
R8777-TAIL:Ncor1	UTSW	11	62433666	missense	probably benign	0.03
R8777-TAIL:Ncor1	UTSW	11	62433668	missense	probably damaging	1.00
R8821:Ncor1	UTSW	11	62369408	missense	probably benign	0.07
R8831:Ncor1	UTSW	11	62369408	missense	probably benign	0.07
R8988:Ncor1	UTSW	11	62343045	nonsense	probably null
R9111:Ncor1	UTSW	11	62389759	missense	possibly damaging	0.95
R9147:Ncor1	UTSW	11	62333846	missense	probably damaging	1.00
R9391:Ncor1	UTSW	11	62325550	nonsense	probably null
X0065:Ncor1	UTSW	11	62354569	critical splice donor site	probably null
X0065:Ncor1	UTSW	11	62358991	missense	probably benign	0.23
Z1176:Ncor1	UTSW	11	62438516	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAAGAGACTGACATGATGCGTAGC -3'
(R):5'- GTCTACAGGATGCGAGCCAGAAATG -3'

Sequencing Primer
(F):5'- ACATGATGCGTAGCTGAGC -3'
(R):5'- CCAGAAATGGGTGGCACTTC -3'

Posted On

2014-03-14