Incidental Mutation 'R1452:Pole2'
ID161090
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Namepolymerase (DNA directed), epsilon 2 (p59 subunit)
SynonymsDNA polymerase epsilon small subunit
MMRRC Submission 039507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1452 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location69201773-69228195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69207929 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 381 (L381F)
Ref Sequence ENSEMBL: ENSMUSP00000152262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411] [ENSMUST00000222699]
Predicted Effect probably benign
Transcript: ENSMUST00000021359
AA Change: L381F

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: L381F

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
AA Change: L381F

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221986
Predicted Effect probably benign
Transcript: ENSMUST00000222699
Meta Mutation Damage Score 0.0840 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.8%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,939 Y415C probably damaging Het
2810474O19Rik A T 6: 149,326,632 K392I probably damaging Het
A2m A G 6: 121,678,056 I1446M probably benign Het
Acaca T A 11: 84,295,059 probably benign Het
Adgre4 A T 17: 55,784,996 E85D probably benign Het
Akt3 A T 1: 177,131,067 Y26N possibly damaging Het
Arl15 T C 13: 113,967,783 V132A probably benign Het
Atp6v1h A G 1: 5,098,137 probably benign Het
Atrip T A 9: 109,072,659 D110V probably damaging Het
Bahcc1 T G 11: 120,282,239 probably benign Het
Cd53 C T 3: 106,768,959 G31S probably damaging Het
Cdk14 T C 5: 4,888,927 S404G possibly damaging Het
Cers3 A T 7: 66,783,404 K156N probably damaging Het
Colgalt2 C A 1: 152,504,153 L448M probably damaging Het
Cox15 G T 19: 43,746,905 T141K probably damaging Het
Csnk2a2 C T 8: 95,457,375 probably benign Het
Cyp2b10 A T 7: 25,925,388 probably benign Het
Cyp2c55 A G 19: 39,011,090 Y80C probably damaging Het
Depdc1a A G 3: 159,526,691 Y693C possibly damaging Het
Des T C 1: 75,363,477 S343P probably damaging Het
Dync1i2 T C 2: 71,249,863 probably benign Het
Eif3m T A 2: 105,006,777 Q199L probably damaging Het
Emsy G T 7: 98,600,674 T802K probably damaging Het
Endov A G 11: 119,491,825 T33A probably damaging Het
Epb41l5 G A 1: 119,549,166 T728I probably damaging Het
Fbxo39 A G 11: 72,318,402 I363V probably benign Het
Gm8674 C T 13: 49,900,517 noncoding transcript Het
Gm9733 G T 3: 15,332,152 T24K unknown Het
Il6st T A 13: 112,481,464 N137K possibly damaging Het
Inf2 A G 12: 112,601,344 N136S probably damaging Het
Iqub A T 6: 24,491,559 I376N probably benign Het
Kansl3 A G 1: 36,354,793 probably benign Het
Kbtbd2 A T 6: 56,781,924 H71Q probably damaging Het
Lgals8 G T 13: 12,453,327 Y140* probably null Het
Macf1 T A 4: 123,493,998 I924L probably benign Het
Mcoln2 A T 3: 146,181,814 T329S possibly damaging Het
Mex3d A T 10: 80,381,520 L621Q probably damaging Het
Mut A G 17: 40,937,468 probably benign Het
Ncor1 T C 11: 62,334,631 H1038R probably damaging Het
Neb A G 2: 52,271,297 probably null Het
Ngrn A G 7: 80,264,772 T224A probably benign Het
Nin G A 12: 70,017,650 R2019* probably null Het
Nphp4 C G 4: 152,547,018 Q792E probably damaging Het
Olfr1047 T A 2: 86,228,455 N172I probably damaging Het
Olfr1166 C T 2: 88,124,311 V225I probably benign Het
Olfr140 C T 2: 90,051,671 V218I possibly damaging Het
Olfr373 C T 8: 72,100,176 Q139* probably null Het
Olfr70 C T 4: 43,696,823 V117M probably benign Het
Pde4dip C A 3: 97,724,102 V1164L probably damaging Het
Plppr1 A G 4: 49,301,067 probably benign Het
Ppp2r5e A G 12: 75,469,536 probably benign Het
Prim2 T A 1: 33,630,404 E163D probably benign Het
Prrc2b A T 2: 32,194,985 D296V probably damaging Het
Pter A G 2: 12,978,621 probably benign Het
Robo2 C A 16: 73,961,910 V662L probably damaging Het
Slco1b2 A T 6: 141,672,200 I424F probably benign Het
Snx29 A T 16: 11,631,471 H260L probably damaging Het
Stil A G 4: 115,039,195 N959S probably benign Het
Taar8c A T 10: 24,101,610 D101E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trpc6 G A 9: 8,653,147 M573I probably damaging Het
Tsr1 A T 11: 74,899,599 D171V probably benign Het
Ube4b T C 4: 149,371,169 T348A probably damaging Het
Vmn1r85 A T 7: 13,084,881 I112N probably damaging Het
Vps36 A G 8: 22,218,210 probably null Het
Wdfy3 G A 5: 101,937,738 A630V possibly damaging Het
Wdsub1 A T 2: 59,876,800 D14E probably null Het
Ylpm1 T C 12: 85,030,383 I1294T possibly damaging Het
Zdhhc17 A G 10: 110,955,075 F378L probably benign Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69226445 splice site probably benign
IGL00940:Pole2 APN 12 69215360 missense probably damaging 1.00
IGL01593:Pole2 APN 12 69223099 splice site probably null
IGL01609:Pole2 APN 12 69207857 critical splice donor site probably null
IGL01717:Pole2 APN 12 69213849 missense probably damaging 1.00
IGL02168:Pole2 APN 12 69201886 unclassified probably benign
IGL02208:Pole2 APN 12 69223162 missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69209875 missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69209985 nonsense probably null
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0396:Pole2 UTSW 12 69222386 splice site probably benign
R0574:Pole2 UTSW 12 69211457 splice site probably benign
R0620:Pole2 UTSW 12 69209879 missense probably damaging 1.00
R0685:Pole2 UTSW 12 69211413 missense probably damaging 0.98
R0791:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1453:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1455:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1912:Pole2 UTSW 12 69209990 missense probably damaging 0.99
R2067:Pole2 UTSW 12 69228152 missense probably benign 0.01
R2929:Pole2 UTSW 12 69209938 missense probably benign 0.13
R3016:Pole2 UTSW 12 69222062 missense probably benign 0.14
R4504:Pole2 UTSW 12 69222468 missense probably benign 0.00
R4765:Pole2 UTSW 12 69222052 missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69226365 missense probably benign 0.00
R4896:Pole2 UTSW 12 69223150 missense probably damaging 0.97
R6998:Pole2 UTSW 12 69213906 missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69202910 missense probably damaging 1.00
R7535:Pole2 UTSW 12 69222429 missense probably benign 0.10
R7841:Pole2 UTSW 12 69204258 missense probably damaging 1.00
R8437:Pole2 UTSW 12 69204187 nonsense probably null
R8506:Pole2 UTSW 12 69208960 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTGAGGAAGCTGGAGATACCAC -3'
(R):5'- AACTGTAGCTAGGCATCATGGCCC -3'

Sequencing Primer
(F):5'- CAGAGTCACTGCTGGTTAAGTATC -3'
(R):5'- ctagcctagactacatagcaagac -3'
Posted On2014-03-14