Mutagenetix > Incidental Mutations

Incidental Mutation 'R1452:Ylpm1'

161093

Institutional Source

Beutler Lab

Gene Symbol

Ylpm1

Ensembl Gene

ENSMUSG00000021244

Gene Name

YLP motif containing 1

Synonyms

ZAP, A930013E17Rik, Zap3

MMRRC Submission

039507-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1452 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

84996321-85070515 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85030383 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1294 (I1294T)

Ref Sequence

ENSEMBL: ENSMUSP00000021670 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021670] [ENSMUST00000101202] [ENSMUST00000164558] [ENSMUST00000168977]

AlphaFold

Q9R0I7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021670
AA Change: I1294T

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021670
Gene: ENSMUSG00000021244
AA Change: I1294T

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC
low complexity region	31	50	N/A	INTRINSIC
low complexity region	57	78	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
low complexity region	94	114	N/A	INTRINSIC
low complexity region	139	225	N/A	INTRINSIC
low complexity region	226	253	N/A	INTRINSIC
low complexity region	341	382	N/A	INTRINSIC
low complexity region	389	407	N/A	INTRINSIC
low complexity region	422	435	N/A	INTRINSIC
low complexity region	455	464	N/A	INTRINSIC
low complexity region	538	654	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	751	763	N/A	INTRINSIC
internal_repeat_1	771	840	4.03e-5	PROSPERO
low complexity region	841	854	N/A	INTRINSIC
low complexity region	966	972	N/A	INTRINSIC
internal_repeat_1	1062	1124	4.03e-5	PROSPERO
low complexity region	1252	1266	N/A	INTRINSIC
low complexity region	1275	1293	N/A	INTRINSIC
low complexity region	1326	1338	N/A	INTRINSIC
low complexity region	1339	1353	N/A	INTRINSIC
low complexity region	1408	1425	N/A	INTRINSIC
coiled coil region	1447	1474	N/A	INTRINSIC
low complexity region	1494	1517	N/A	INTRINSIC
low complexity region	1518	1532	N/A	INTRINSIC
low complexity region	1536	1557	N/A	INTRINSIC
low complexity region	1598	1630	N/A	INTRINSIC
low complexity region	1678	1694	N/A	INTRINSIC
low complexity region	1705	1717	N/A	INTRINSIC
low complexity region	1720	1736	N/A	INTRINSIC
low complexity region	1797	1808	N/A	INTRINSIC
Pfam:AAA_33	1829	1990	7.8e-11	PFAM
coiled coil region	1995	2032	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101202

SMART Domains

Protein: ENSMUSP00000098763
Gene: ENSMUSG00000021244

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC
low complexity region	31	50	N/A	INTRINSIC
low complexity region	57	78	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
low complexity region	94	114	N/A	INTRINSIC
low complexity region	139	206	N/A	INTRINSIC
low complexity region	294	335	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
low complexity region	375	388	N/A	INTRINSIC
low complexity region	408	417	N/A	INTRINSIC
low complexity region	491	607	N/A	INTRINSIC
low complexity region	641	649	N/A	INTRINSIC
low complexity region	741	764	N/A	INTRINSIC
low complexity region	765	779	N/A	INTRINSIC
low complexity region	783	804	N/A	INTRINSIC
low complexity region	845	877	N/A	INTRINSIC
low complexity region	925	941	N/A	INTRINSIC
low complexity region	952	964	N/A	INTRINSIC
low complexity region	967	983	N/A	INTRINSIC
low complexity region	1044	1055	N/A	INTRINSIC
Pfam:AAA_33	1076	1265	4.9e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164558
AA Change: I836T

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000126347
Gene: ENSMUSG00000021244
AA Change: I836T

Domain	Start	End	E-Value	Type
low complexity region	80	196	N/A	INTRINSIC
low complexity region	230	238	N/A	INTRINSIC
low complexity region	293	305	N/A	INTRINSIC
low complexity region	383	396	N/A	INTRINSIC
low complexity region	508	514	N/A	INTRINSIC
low complexity region	794	808	N/A	INTRINSIC
low complexity region	817	835	N/A	INTRINSIC
low complexity region	868	880	N/A	INTRINSIC
low complexity region	881	895	N/A	INTRINSIC
low complexity region	950	967	N/A	INTRINSIC
coiled coil region	989	1016	N/A	INTRINSIC
low complexity region	1036	1059	N/A	INTRINSIC
low complexity region	1060	1074	N/A	INTRINSIC
low complexity region	1078	1099	N/A	INTRINSIC
low complexity region	1140	1172	N/A	INTRINSIC
low complexity region	1220	1236	N/A	INTRINSIC
low complexity region	1247	1259	N/A	INTRINSIC
low complexity region	1262	1278	N/A	INTRINSIC
low complexity region	1339	1350	N/A	INTRINSIC
Pfam:AAA_33	1371	1559	5.2e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168977

SMART Domains

Protein: ENSMUSP00000128962
Gene: ENSMUSG00000021244

Domain	Start	End	E-Value	Type
low complexity region	15	26	N/A	INTRINSIC
low complexity region	31	50	N/A	INTRINSIC
low complexity region	57	78	N/A	INTRINSIC
low complexity region	79	91	N/A	INTRINSIC
low complexity region	94	114	N/A	INTRINSIC
low complexity region	139	225	N/A	INTRINSIC
low complexity region	226	253	N/A	INTRINSIC
low complexity region	341	382	N/A	INTRINSIC
low complexity region	389	407	N/A	INTRINSIC
low complexity region	422	435	N/A	INTRINSIC
low complexity region	455	464	N/A	INTRINSIC
low complexity region	538	654	N/A	INTRINSIC
low complexity region	688	696	N/A	INTRINSIC
low complexity region	788	811	N/A	INTRINSIC
low complexity region	812	826	N/A	INTRINSIC
low complexity region	830	851	N/A	INTRINSIC
low complexity region	892	924	N/A	INTRINSIC
low complexity region	972	988	N/A	INTRINSIC
low complexity region	999	1011	N/A	INTRINSIC
low complexity region	1014	1030	N/A	INTRINSIC
low complexity region	1091	1102	N/A	INTRINSIC
Pfam:AAA_33	1123	1311	4.5e-11	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.8%
20x: 87.5%

Validation Efficiency

99% (70/71)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,939	Y415C	probably damaging	Het
2810474O19Rik	A	T	6: 149,326,632	K392I	probably damaging	Het
A2m	A	G	6: 121,678,056	I1446M	probably benign	Het
Acaca	T	A	11: 84,295,059		probably benign	Het
Adgre4	A	T	17: 55,784,996	E85D	probably benign	Het
Akt3	A	T	1: 177,131,067	Y26N	possibly damaging	Het
Arl15	T	C	13: 113,967,783	V132A	probably benign	Het
Atp6v1h	A	G	1: 5,098,137		probably benign	Het
Atrip	T	A	9: 109,072,659	D110V	probably damaging	Het
Bahcc1	T	G	11: 120,282,239		probably benign	Het
Cd53	C	T	3: 106,768,959	G31S	probably damaging	Het
Cdk14	T	C	5: 4,888,927	S404G	possibly damaging	Het
Cers3	A	T	7: 66,783,404	K156N	probably damaging	Het
Colgalt2	C	A	1: 152,504,153	L448M	probably damaging	Het
Cox15	G	T	19: 43,746,905	T141K	probably damaging	Het
Csnk2a2	C	T	8: 95,457,375		probably benign	Het
Cyp2b10	A	T	7: 25,925,388		probably benign	Het
Cyp2c55	A	G	19: 39,011,090	Y80C	probably damaging	Het
Depdc1a	A	G	3: 159,526,691	Y693C	possibly damaging	Het
Des	T	C	1: 75,363,477	S343P	probably damaging	Het
Dync1i2	T	C	2: 71,249,863		probably benign	Het
Eif3m	T	A	2: 105,006,777	Q199L	probably damaging	Het
Emsy	G	T	7: 98,600,674	T802K	probably damaging	Het
Endov	A	G	11: 119,491,825	T33A	probably damaging	Het
Epb41l5	G	A	1: 119,549,166	T728I	probably damaging	Het
Fbxo39	A	G	11: 72,318,402	I363V	probably benign	Het
Gm8674	C	T	13: 49,900,517		noncoding transcript	Het
Gm9733	G	T	3: 15,332,152	T24K	unknown	Het
Il6st	T	A	13: 112,481,464	N137K	possibly damaging	Het
Inf2	A	G	12: 112,601,344	N136S	probably damaging	Het
Iqub	A	T	6: 24,491,559	I376N	probably benign	Het
Kansl3	A	G	1: 36,354,793		probably benign	Het
Kbtbd2	A	T	6: 56,781,924	H71Q	probably damaging	Het
Lgals8	G	T	13: 12,453,327	Y140*	probably null	Het
Macf1	T	A	4: 123,493,998	I924L	probably benign	Het
Mcoln2	A	T	3: 146,181,814	T329S	possibly damaging	Het
Mex3d	A	T	10: 80,381,520	L621Q	probably damaging	Het
Mut	A	G	17: 40,937,468		probably benign	Het
Ncor1	T	C	11: 62,334,631	H1038R	probably damaging	Het
Neb	A	G	2: 52,271,297		probably null	Het
Ngrn	A	G	7: 80,264,772	T224A	probably benign	Het
Nin	G	A	12: 70,017,650	R2019*	probably null	Het
Nphp4	C	G	4: 152,547,018	Q792E	probably damaging	Het
Olfr1047	T	A	2: 86,228,455	N172I	probably damaging	Het
Olfr1166	C	T	2: 88,124,311	V225I	probably benign	Het
Olfr140	C	T	2: 90,051,671	V218I	possibly damaging	Het
Olfr373	C	T	8: 72,100,176	Q139*	probably null	Het
Olfr70	C	T	4: 43,696,823	V117M	probably benign	Het
Pde4dip	C	A	3: 97,724,102	V1164L	probably damaging	Het
Plppr1	A	G	4: 49,301,067		probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Ppp2r5e	A	G	12: 75,469,536		probably benign	Het
Prim2	T	A	1: 33,630,404	E163D	probably benign	Het
Prrc2b	A	T	2: 32,194,985	D296V	probably damaging	Het
Pter	A	G	2: 12,978,621		probably benign	Het
Robo2	C	A	16: 73,961,910	V662L	probably damaging	Het
Slco1b2	A	T	6: 141,672,200	I424F	probably benign	Het
Snx29	A	T	16: 11,631,471	H260L	probably damaging	Het
Stil	A	G	4: 115,039,195	N959S	probably benign	Het
Taar8c	A	T	10: 24,101,610	D101E	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	G	A	9: 8,653,147	M573I	probably damaging	Het
Tsr1	A	T	11: 74,899,599	D171V	probably benign	Het
Ube4b	T	C	4: 149,371,169	T348A	probably damaging	Het
Vmn1r85	A	T	7: 13,084,881	I112N	probably damaging	Het
Vps36	A	G	8: 22,218,210		probably null	Het
Wdfy3	G	A	5: 101,937,738	A630V	possibly damaging	Het
Wdsub1	A	T	2: 59,876,800	D14E	probably null	Het
Zdhhc17	A	G	10: 110,955,075	F378L	probably benign	Het

Other mutations in Ylpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ylpm1	APN	12	85028954	missense	possibly damaging	0.93
IGL00809:Ylpm1	APN	12	85049194	missense	probably damaging	0.99
IGL01508:Ylpm1	APN	12	85015455	missense	possibly damaging	0.74
IGL02199:Ylpm1	APN	12	85034005	nonsense	probably null
IGL02392:Ylpm1	APN	12	85014957	missense	unknown
IGL02455:Ylpm1	APN	12	85030263	missense	probably damaging	1.00
IGL02506:Ylpm1	APN	12	85049191	missense	probably damaging	1.00
IGL03102:Ylpm1	APN	12	85049258	splice site	probably benign
I1329:Ylpm1	UTSW	12	85040880	missense	probably damaging	1.00
IGL02799:Ylpm1	UTSW	12	85044484	missense	probably damaging	1.00
R0010:Ylpm1	UTSW	12	85029026	missense	probably damaging	0.97
R0090:Ylpm1	UTSW	12	85029040	intron	probably benign
R0149:Ylpm1	UTSW	12	85028838	missense	probably damaging	0.99
R0226:Ylpm1	UTSW	12	85049737	missense	probably benign	0.21
R0375:Ylpm1	UTSW	12	85014980	missense	unknown
R0378:Ylpm1	UTSW	12	84997076	intron	probably benign
R0507:Ylpm1	UTSW	12	85029112	missense	probably benign	0.03
R0742:Ylpm1	UTSW	12	85029112	missense	probably benign	0.03
R1350:Ylpm1	UTSW	12	85014082	unclassified	probably benign
R1500:Ylpm1	UTSW	12	85014996	missense	unknown
R1837:Ylpm1	UTSW	12	85029333	missense	possibly damaging	0.92
R1945:Ylpm1	UTSW	12	85015418	missense	probably damaging	0.98
R1971:Ylpm1	UTSW	12	85040786	missense	probably damaging	1.00
R2211:Ylpm1	UTSW	12	85044378	nonsense	probably null
R2213:Ylpm1	UTSW	12	85069718	missense	probably benign	0.25
R2269:Ylpm1	UTSW	12	85015050	missense	unknown
R2300:Ylpm1	UTSW	12	85060319	splice site	probably null
R2439:Ylpm1	UTSW	12	85014117	unclassified	probably benign
R2497:Ylpm1	UTSW	12	84996761	missense	probably damaging	0.98
R2890:Ylpm1	UTSW	12	85029813	missense	probably damaging	0.99
R3111:Ylpm1	UTSW	12	85029371	missense	probably damaging	0.98
R3436:Ylpm1	UTSW	12	85049870	critical splice donor site	probably null
R3437:Ylpm1	UTSW	12	85049870	critical splice donor site	probably null
R4156:Ylpm1	UTSW	12	85057403	intron	probably benign
R4157:Ylpm1	UTSW	12	85057403	intron	probably benign
R4959:Ylpm1	UTSW	12	85049945	missense	probably damaging	1.00
R5014:Ylpm1	UTSW	12	85014749	missense	unknown
R5039:Ylpm1	UTSW	12	85015493	missense	probably damaging	0.98
R5039:Ylpm1	UTSW	12	85042239	missense	probably damaging	1.00
R5084:Ylpm1	UTSW	12	85029321	missense	probably damaging	0.99
R5325:Ylpm1	UTSW	12	85013961	unclassified	probably benign
R5378:Ylpm1	UTSW	12	85030255	missense	probably damaging	0.99
R5428:Ylpm1	UTSW	12	85030229	missense	probably benign	0.04
R5467:Ylpm1	UTSW	12	84996859	missense	unknown
R5605:Ylpm1	UTSW	12	85028853	missense	probably damaging	1.00
R5614:Ylpm1	UTSW	12	85064944	intron	probably benign
R5748:Ylpm1	UTSW	12	85060251	splice site	probably null
R5860:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R5861:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R5881:Ylpm1	UTSW	12	85042125	missense	probably damaging	1.00
R5909:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R5912:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R5915:Ylpm1	UTSW	12	85040886	missense	probably damaging	1.00
R6000:Ylpm1	UTSW	12	84997256	missense	unknown
R6004:Ylpm1	UTSW	12	85029084	missense	possibly damaging	0.78
R6007:Ylpm1	UTSW	12	85029290	missense	probably benign	0.33
R6053:Ylpm1	UTSW	12	84996503	missense	possibly damaging	0.72
R6104:Ylpm1	UTSW	12	85029630	missense	probably benign	0.00
R6197:Ylpm1	UTSW	12	85042179	missense	probably damaging	1.00
R6293:Ylpm1	UTSW	12	85015277	missense	unknown
R6297:Ylpm1	UTSW	12	85015277	missense	unknown
R6305:Ylpm1	UTSW	12	85030545	missense	probably damaging	1.00
R6379:Ylpm1	UTSW	12	85030800	missense	probably damaging	1.00
R6465:Ylpm1	UTSW	12	85049802	missense	probably damaging	1.00
R6608:Ylpm1	UTSW	12	85015277	missense	unknown
R6609:Ylpm1	UTSW	12	85015277	missense	unknown
R6737:Ylpm1	UTSW	12	85030846	missense	probably damaging	0.98
R6794:Ylpm1	UTSW	12	84996881	missense	unknown
R7383:Ylpm1	UTSW	12	85044468	missense	possibly damaging	0.93
R7514:Ylpm1	UTSW	12	85030494	missense	possibly damaging	0.94
R7577:Ylpm1	UTSW	12	84997220	missense	unknown
R7709:Ylpm1	UTSW	12	85013025	missense	unknown
R7718:Ylpm1	UTSW	12	85029122	missense	probably damaging	0.99
R7736:Ylpm1	UTSW	12	85012983	missense	unknown
R7758:Ylpm1	UTSW	12	85015022	missense	unknown
R7807:Ylpm1	UTSW	12	85014081	nonsense	probably null
R7838:Ylpm1	UTSW	12	85048866	missense	possibly damaging	0.90
R7846:Ylpm1	UTSW	12	85057268	missense	probably damaging	0.98
R8170:Ylpm1	UTSW	12	85034027	missense	probably benign	0.40
R8776:Ylpm1	UTSW	12	85030421	missense	probably damaging	1.00
R8776-TAIL:Ylpm1	UTSW	12	85030421	missense	probably damaging	1.00
R8812:Ylpm1	UTSW	12	84996792	missense	unknown
R8847:Ylpm1	UTSW	12	85014898	missense	unknown
R8874:Ylpm1	UTSW	12	85069620	missense	probably damaging	1.00
R9129:Ylpm1	UTSW	12	85057278	missense
R9165:Ylpm1	UTSW	12	85030568	missense	probably damaging	1.00
R9198:Ylpm1	UTSW	12	85033915	critical splice acceptor site	probably null
Z1088:Ylpm1	UTSW	12	85030155	missense	possibly damaging	0.95
Z1176:Ylpm1	UTSW	12	85030284	missense	possibly damaging	0.93
Z1177:Ylpm1	UTSW	12	85057283	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGCTCCAATTGAGCGAGAAAGACTC -3'
(R):5'- TCTGACTGAGAACCATTACCCCTCC -3'

Sequencing Primer
(F):5'- GTGAACGTGACTATCAAGATGATAC -3'
(R):5'- CATGGGGGAATGTCTATCCACATC -3'

Posted On

2014-03-14