Mutagenetix > Incidental Mutation

Incidental Mutation 'R1452:Gm8674'

161096

Institutional Source

Beutler Lab

Gene Symbol

Gm8674

Ensembl Gene

ENSMUSG00000093976

Gene Name

predicted gene 8674

Synonyms

MMRRC Submission

039507-MU

Accession Numbers

Genbank: XM_990959; MGI: 3645762

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R1452 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49899119-49904597 bp(-) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

C to T at 49900517 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000179367

SMART Domains

Protein: ENSMUSP00000137219
Gene: ENSMUSG00000093976

Domain	Start	End	E-Value	Type
low complexity region	70	86	N/A	INTRINSIC
Pfam:FAM75	92	444	3.6e-27	PFAM

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.8%
20x: 87.5%

Validation Efficiency

99% (70/71)

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310007B03Rik	T	C	1: 93,152,939	Y415C	probably damaging	Het
2810474O19Rik	A	T	6: 149,326,632	K392I	probably damaging	Het
A2m	A	G	6: 121,678,056	I1446M	probably benign	Het
Acaca	T	A	11: 84,295,059		probably benign	Het
Adgre4	A	T	17: 55,784,996	E85D	probably benign	Het
Akt3	A	T	1: 177,131,067	Y26N	possibly damaging	Het
Arl15	T	C	13: 113,967,783	V132A	probably benign	Het
Atp6v1h	A	G	1: 5,098,137		probably benign	Het
Atrip	T	A	9: 109,072,659	D110V	probably damaging	Het
Bahcc1	T	G	11: 120,282,239		probably benign	Het
Cd53	C	T	3: 106,768,959	G31S	probably damaging	Het
Cdk14	T	C	5: 4,888,927	S404G	possibly damaging	Het
Cers3	A	T	7: 66,783,404	K156N	probably damaging	Het
Colgalt2	C	A	1: 152,504,153	L448M	probably damaging	Het
Cox15	G	T	19: 43,746,905	T141K	probably damaging	Het
Csnk2a2	C	T	8: 95,457,375		probably benign	Het
Cyp2b10	A	T	7: 25,925,388		probably benign	Het
Cyp2c55	A	G	19: 39,011,090	Y80C	probably damaging	Het
Depdc1a	A	G	3: 159,526,691	Y693C	possibly damaging	Het
Des	T	C	1: 75,363,477	S343P	probably damaging	Het
Dync1i2	T	C	2: 71,249,863		probably benign	Het
Eif3m	T	A	2: 105,006,777	Q199L	probably damaging	Het
Emsy	G	T	7: 98,600,674	T802K	probably damaging	Het
Endov	A	G	11: 119,491,825	T33A	probably damaging	Het
Epb41l5	G	A	1: 119,549,166	T728I	probably damaging	Het
Fbxo39	A	G	11: 72,318,402	I363V	probably benign	Het
Gm9733	G	T	3: 15,332,152	T24K	unknown	Het
Il6st	T	A	13: 112,481,464	N137K	possibly damaging	Het
Inf2	A	G	12: 112,601,344	N136S	probably damaging	Het
Iqub	A	T	6: 24,491,559	I376N	probably benign	Het
Kansl3	A	G	1: 36,354,793		probably benign	Het
Kbtbd2	A	T	6: 56,781,924	H71Q	probably damaging	Het
Lgals8	G	T	13: 12,453,327	Y140*	probably null	Het
Macf1	T	A	4: 123,493,998	I924L	probably benign	Het
Mcoln2	A	T	3: 146,181,814	T329S	possibly damaging	Het
Mex3d	A	T	10: 80,381,520	L621Q	probably damaging	Het
Mut	A	G	17: 40,937,468		probably benign	Het
Ncor1	T	C	11: 62,334,631	H1038R	probably damaging	Het
Neb	A	G	2: 52,271,297		probably null	Het
Ngrn	A	G	7: 80,264,772	T224A	probably benign	Het
Nin	G	A	12: 70,017,650	R2019*	probably null	Het
Nphp4	C	G	4: 152,547,018	Q792E	probably damaging	Het
Olfr1047	T	A	2: 86,228,455	N172I	probably damaging	Het
Olfr1166	C	T	2: 88,124,311	V225I	probably benign	Het
Olfr140	C	T	2: 90,051,671	V218I	possibly damaging	Het
Olfr373	C	T	8: 72,100,176	Q139*	probably null	Het
Olfr70	C	T	4: 43,696,823	V117M	probably benign	Het
Pde4dip	C	A	3: 97,724,102	V1164L	probably damaging	Het
Plppr1	A	G	4: 49,301,067		probably benign	Het
Pole2	G	A	12: 69,207,929	L381F	probably benign	Het
Ppp2r5e	A	G	12: 75,469,536		probably benign	Het
Prim2	T	A	1: 33,630,404	E163D	probably benign	Het
Prrc2b	A	T	2: 32,194,985	D296V	probably damaging	Het
Pter	A	G	2: 12,978,621		probably benign	Het
Robo2	C	A	16: 73,961,910	V662L	probably damaging	Het
Slco1b2	A	T	6: 141,672,200	I424F	probably benign	Het
Snx29	A	T	16: 11,631,471	H260L	probably damaging	Het
Stil	A	G	4: 115,039,195	N959S	probably benign	Het
Taar8c	A	T	10: 24,101,610	D101E	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trpc6	G	A	9: 8,653,147	M573I	probably damaging	Het
Tsr1	A	T	11: 74,899,599	D171V	probably benign	Het
Ube4b	T	C	4: 149,371,169	T348A	probably damaging	Het
Vmn1r85	A	T	7: 13,084,881	I112N	probably damaging	Het
Vps36	A	G	8: 22,218,210		probably null	Het
Wdfy3	G	A	5: 101,937,738	A630V	possibly damaging	Het
Wdsub1	A	T	2: 59,876,800	D14E	probably null	Het
Ylpm1	T	C	12: 85,030,383	I1294T	possibly damaging	Het
Zdhhc17	A	G	10: 110,955,075	F378L	probably benign	Het

Other mutations in Gm8674

Allele	Source	Chr	Coord	Type	Predicted Effect
R0355:Gm8674	UTSW	13	49901939	exon	noncoding transcript
R0357:Gm8674	UTSW	13	49902113	exon	noncoding transcript
R0627:Gm8674	UTSW	13	49899715	exon	noncoding transcript
R0833:Gm8674	UTSW	13	49904575	exon	noncoding transcript
R1300:Gm8674	UTSW	13	49901722	exon	noncoding transcript
R1542:Gm8674	UTSW	13	49900003	exon	noncoding transcript
R1613:Gm8674	UTSW	13	49902438	intron	noncoding transcript
R1643:Gm8674	UTSW	13	49901358	exon	noncoding transcript
R1732:Gm8674	UTSW	13	49901926	exon	noncoding transcript
R1824:Gm8674	UTSW	13	49900808	exon	noncoding transcript
R1840:Gm8674	UTSW	13	49901765	exon	noncoding transcript
R1915:Gm8674	UTSW	13	49900853	exon	noncoding transcript
R1934:Gm8674	UTSW	13	49901435	exon	noncoding transcript
R2040:Gm8674	UTSW	13	49901669	exon	noncoding transcript
R2214:Gm8674	UTSW	13	49901360	exon	noncoding transcript
R2421:Gm8674	UTSW	13	49900663	exon	noncoding transcript
R3423:Gm8674	UTSW	13	49901756	exon	noncoding transcript
R3425:Gm8674	UTSW	13	49901756	exon	noncoding transcript
R3886:Gm8674	UTSW	13	49902163	splice site	noncoding transcript
R4083:Gm8674	UTSW	13	49901011	exon	noncoding transcript
R4343:Gm8674	UTSW	13	49899706	exon	noncoding transcript
R4570:Gm8674	UTSW	13	49902534	intron	noncoding transcript
R4936:Gm8674	UTSW	13	49900755	exon	noncoding transcript
R4967:Gm8674	UTSW	13	49901998	exon	noncoding transcript
R5065:Gm8674	UTSW	13	49902577	intron	noncoding transcript
R5067:Gm8674	UTSW	13	49899834	exon	noncoding transcript
R5120:Gm8674	UTSW	13	49901948	exon	noncoding transcript
R5208:Gm8674	UTSW	13	49901921	exon	noncoding transcript
R5268:Gm8674	UTSW	13	49901354	exon	noncoding transcript
R5471:Gm8674	UTSW	13	49900813	exon	noncoding transcript
R5773:Gm8674	UTSW	13	49901876	exon	noncoding transcript
R5809:Gm8674	UTSW	13	49901888	exon	noncoding transcript
R8162:Gm8674	UTSW	13	49900371	missense	noncoding transcript
R8239:Gm8674	UTSW	13	49900226	missense	noncoding transcript
Z1088:Gm8674	UTSW	13	49900794	exon	noncoding transcript
Z1088:Gm8674	UTSW	13	49901248	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- AGGCAAGATGGCCTTGGCAATATG -3'
(R):5'- GGAGAGCAAGAATGTCCCTGCAAC -3'

Sequencing Primer
(F):5'- CAATATGTAATGTACTGGGGCCATC -3'
(R):5'- GCTTCCACTACAAAAGAGGTTTCAG -3'

Posted On

2014-03-14