Incidental Mutation 'R1422:Cr2'
ID161110
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Namecomplement receptor 2
SynonymsC3DR, CD21, Cr-1, Cr1, CD35, Cr-2
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location195136811-195176716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 195171125 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 35 (I35T)
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
Predicted Effect probably benign
Transcript: ENSMUST00000043104
AA Change: I15T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616
AA Change: I15T

DomainStartEndE-ValueType
CCP 2 58 5.04e-7 SMART
CCP 63 120 3.58e-12 SMART
CCP 125 191 1.2e-13 SMART
CCP 197 252 2.73e-17 SMART
CCP 256 311 1.01e-15 SMART
Blast:CCP 316 347 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000082321
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194149
Predicted Effect probably benign
Transcript: ENSMUST00000195120
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195722
Predicted Effect probably benign
Transcript: ENSMUST00000210219
AA Change: I35T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7350:Cr2 UTSW 1 195155286 missense probably benign 0.21
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7453:Cr2 UTSW 1 195165257 splice site probably null
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
R7570:Cr2 UTSW 1 195169340 nonsense probably null
R7666:Cr2 UTSW 1 195154225 missense probably damaging 1.00
R7921:Cr2 UTSW 1 195151667 missense possibly damaging 0.94
R7923:Cr2 UTSW 1 195168687 missense probably benign 0.03
R8396:Cr2 UTSW 1 195158068 missense probably damaging 1.00
R8503:Cr2 UTSW 1 195163542 missense probably benign
R8517:Cr2 UTSW 1 195155899 missense probably benign 0.03
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Z1176:Cr2 UTSW 1 195154153 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- AGCATAAACTGTGGTGGTGACTTACAC -3'
(R):5'- TAGAGAGTGCTGCTGTCTCACAGG -3'

Sequencing Primer
(F):5'- GGTGGTGACTTACACACTAGTACTC -3'
(R):5'- CCAGATCCTCCTCTGAAGTATG -3'
Posted On2014-03-14