Mutagenetix > Incidental Mutation

Incidental Mutation 'R1422:Atrn'

161113

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

039478-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1422 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 130957914 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 404 (Y404H)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

probably damaging
Transcript: ENSMUST00000028781
AA Change: Y404H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: Y404H

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Meta Mutation Damage Score

0.7140

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.2%
20x: 89.6%

Validation Efficiency

100% (51/51)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700062C07Rik	A	G	18: 24,477,276	T170A	probably benign	Het
3110002H16Rik	G	A	18: 12,181,623	D87N	probably damaging	Het
4931408C20Rik	C	G	1: 26,682,466	S1211T	possibly damaging	Het
Arhgap5	T	A	12: 52,519,514	D1089E	probably damaging	Het
Becn1	T	C	11: 101,295,126	D98G	possibly damaging	Het
Coro2b	A	G	9: 62,428,947		probably null	Het
Cpne4	T	C	9: 104,900,285	I143T	probably damaging	Het
Cr2	A	G	1: 195,171,125	I35T	probably benign	Het
Ctns	T	C	11: 73,185,246	Y321C	probably damaging	Het
Cyp4f16	A	T	17: 32,542,999	M174L	probably damaging	Het
Dpy19l4	T	C	4: 11,317,168	E10G	possibly damaging	Het
Dtx3	T	A	10: 127,191,289	I339F	possibly damaging	Het
Fam184a	A	T	10: 53,675,208	M625K	probably benign	Het
Fgd6	A	G	10: 94,045,372	E696G	probably damaging	Het
Gm14685	G	T	X: 73,127,655	G218C	probably damaging	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Gria1	T	A	11: 57,189,788	L199Q	probably benign	Het
Hk1	T	C	10: 62,296,094	D184G	probably null	Het
Ift88	T	C	14: 57,438,301		probably benign	Het
Ift88	G	A	14: 57,472,979	V403M	probably damaging	Het
Igsf1	C	A	X: 49,782,936	G737*	probably null	Het
Kif19a	A	G	11: 114,785,809	D488G	probably benign	Het
Lpcat2	T	C	8: 92,879,417	L232P	probably damaging	Het
Ly9	A	G	1: 171,601,212	V280A	probably damaging	Het
Macrod2	T	A	2: 140,419,941		probably null	Het
Mmp1a	A	G	9: 7,464,298		probably null	Het
Mmrn2	A	G	14: 34,396,239	H80R	probably damaging	Het
Olfr1156	G	A	2: 87,950,095	T46I	probably benign	Het
Olfr124	T	C	17: 37,805,363	Y73H	probably damaging	Het
Olfr564	G	A	7: 102,803,850	R124H	probably benign	Het
Pkd1l3	C	A	8: 109,621,708	P194H	unknown	Het
Plk2	A	G	13: 110,399,489	M576V	probably damaging	Het
Pms2	T	A	5: 143,913,705	S113T	probably damaging	Het
Ptprk	A	G	10: 28,475,280	I590V	possibly damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Rad17	A	G	13: 100,645,082	L69P	probably benign	Het
Robo2	G	A	16: 73,978,448	T466M	probably damaging	Het
Sema6a	A	G	18: 47,306,431	C9R	probably benign	Het
Slc6a19	A	G	13: 73,685,869	S357P	probably benign	Het
Spock3	T	C	8: 63,143,989	I109T	possibly damaging	Het
Svs6	T	C	2: 164,317,660		probably null	Het
Tenm4	A	T	7: 96,550,051	D17V	probably damaging	Het
Trp53bp2	T	A	1: 182,446,464	M558K	probably benign	Het
Ttn	T	C	2: 76,741,670	E26293G	probably damaging	Het
Vmn1r29	A	G	6: 58,307,886	Y197C	probably damaging	Het
Wdfy3	A	T	5: 101,884,214		probably benign	Het
Zfp366	A	G	13: 99,229,296	K322E	probably damaging	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1807:Atrn	UTSW	2	130982772	missense	possibly damaging	0.94
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTCAGCAAGCCTATGCCCATTATC -3'
(R):5'- GGCCAGATGCCAGTGTAACAATGTG -3'

Sequencing Primer
(F):5'- tccagaggtcagaagaggatg -3'
(R):5'- CAATGTGTGCTGAGTGTCCAAC -3'

Posted On

2014-03-14