Incidental Mutation 'R1422:Dpy19l4'
ID161116
Institutional Source Beutler Lab
Gene Symbol Dpy19l4
Ensembl Gene ENSMUSG00000045205
Gene Namedpy-19-like 4 (C. elegans)
SynonymsNarg3, LOC381510
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location11261315-11322137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11317168 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 10 (E10G)
Ref Sequence ENSEMBL: ENSMUSP00000119923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084892] [ENSMUST00000128024] [ENSMUST00000142005]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084892
AA Change: E10G

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081954
Gene: ENSMUSG00000045205
AA Change: E10G

DomainStartEndE-ValueType
Pfam:Dpy19 59 714 3e-213 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128024
AA Change: E10G

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122823
Gene: ENSMUSG00000045205
AA Change: E10G

DomainStartEndE-ValueType
Pfam:Dpy19 58 293 1e-89 PFAM
Pfam:Dpy19 291 524 4.8e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142005
AA Change: E10G

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119923
Gene: ENSMUSG00000045205
AA Change: E10G

DomainStartEndE-ValueType
Pfam:Dpy19 58 253 6.9e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148524
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181105
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Dpy19l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dpy19l4 APN 4 11290411 missense probably benign 0.00
IGL01402:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01404:Dpy19l4 APN 4 11273006 critical splice donor site probably null
IGL01643:Dpy19l4 APN 4 11290184 splice site probably benign
IGL01758:Dpy19l4 APN 4 11265846 missense probably damaging 1.00
IGL01896:Dpy19l4 APN 4 11267752 missense possibly damaging 0.81
IGL02222:Dpy19l4 APN 4 11281116 missense possibly damaging 0.93
IGL02314:Dpy19l4 APN 4 11267720 missense possibly damaging 0.50
IGL02422:Dpy19l4 APN 4 11265803 missense possibly damaging 0.95
IGL02565:Dpy19l4 APN 4 11309440 missense probably benign 0.14
IGL03121:Dpy19l4 APN 4 11303334 missense probably damaging 1.00
IGL03357:Dpy19l4 APN 4 11267615 missense probably damaging 1.00
IGL03368:Dpy19l4 APN 4 11290253 missense possibly damaging 0.53
R0003:Dpy19l4 UTSW 4 11267619 missense probably damaging 1.00
R0481:Dpy19l4 UTSW 4 11272993 splice site probably benign
R0506:Dpy19l4 UTSW 4 11289715 missense probably benign 0.07
R1114:Dpy19l4 UTSW 4 11287643 splice site probably benign
R1332:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1336:Dpy19l4 UTSW 4 11276901 missense probably damaging 1.00
R1355:Dpy19l4 UTSW 4 11303371 nonsense probably null
R1421:Dpy19l4 UTSW 4 11304011 missense probably benign 0.09
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1465:Dpy19l4 UTSW 4 11296034 missense probably damaging 1.00
R1766:Dpy19l4 UTSW 4 11303360 missense probably damaging 1.00
R1803:Dpy19l4 UTSW 4 11281020 missense possibly damaging 0.81
R2090:Dpy19l4 UTSW 4 11304344 missense probably benign 0.34
R2324:Dpy19l4 UTSW 4 11276857 unclassified probably benign
R2446:Dpy19l4 UTSW 4 11304143 splice site probably null
R3769:Dpy19l4 UTSW 4 11276868 splice site probably null
R4151:Dpy19l4 UTSW 4 11309485 missense possibly damaging 0.89
R4472:Dpy19l4 UTSW 4 11304053 missense possibly damaging 0.91
R4609:Dpy19l4 UTSW 4 11295999 nonsense probably null
R4708:Dpy19l4 UTSW 4 11277970 missense probably benign 0.00
R4722:Dpy19l4 UTSW 4 11290521 missense possibly damaging 0.84
R4997:Dpy19l4 UTSW 4 11287493 missense probably benign 0.01
R5085:Dpy19l4 UTSW 4 11265943 critical splice acceptor site probably null
R5088:Dpy19l4 UTSW 4 11303357 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11289721 missense probably damaging 1.00
R5288:Dpy19l4 UTSW 4 11304014 missense probably damaging 1.00
R5413:Dpy19l4 UTSW 4 11289700 missense probably damaging 1.00
R5758:Dpy19l4 UTSW 4 11276886 missense probably damaging 1.00
R6024:Dpy19l4 UTSW 4 11276876 missense probably damaging 1.00
R6312:Dpy19l4 UTSW 4 11289671 nonsense probably null
R6339:Dpy19l4 UTSW 4 11285111 missense probably damaging 0.98
R7055:Dpy19l4 UTSW 4 11290291 critical splice acceptor site probably null
R7359:Dpy19l4 UTSW 4 11273125 missense probably benign 0.00
R7525:Dpy19l4 UTSW 4 11317160 nonsense probably null
R7579:Dpy19l4 UTSW 4 11265909 missense probably benign 0.39
R7913:Dpy19l4 UTSW 4 11265859 nonsense probably null
R8047:Dpy19l4 UTSW 4 11317139 missense probably benign 0.00
R8049:Dpy19l4 UTSW 4 11303982 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- ACAGGGGCTATTCCTTCCTGACAC -3'
(R):5'- AGTCACATGATCTCCAGGCTTTGC -3'

Sequencing Primer
(F):5'- cccactcaacacctcaaaac -3'
(R):5'- GACTCGATTCCGTCTGTATCAGAG -3'
Posted On2014-03-14