Incidental Mutation 'R1422:Vmn1r29'
ID161119
Institutional Source Beutler Lab
Gene Symbol Vmn1r29
Ensembl Gene ENSMUSG00000091734
Gene Namevomeronasal 1 receptor 29
SynonymsV1rc2
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location58301549-58311685 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58307886 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 197 (Y197C)
Ref Sequence ENSEMBL: ENSMUSP00000154278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168416] [ENSMUST00000226971] [ENSMUST00000227761] [ENSMUST00000228038] [ENSMUST00000228909]
Predicted Effect probably damaging
Transcript: ENSMUST00000168416
AA Change: Y197C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129069
Gene: ENSMUSG00000091734
AA Change: Y197C

DomainStartEndE-ValueType
Pfam:V1R 28 293 1.7e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226971
AA Change: Y197C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227761
AA Change: Y197C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228038
AA Change: Y197C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228909
AA Change: Y197C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Vmn1r29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02504:Vmn1r29 APN 6 58307670 missense probably benign 0.03
IGL03351:Vmn1r29 APN 6 58307750 missense probably damaging 1.00
R0457:Vmn1r29 UTSW 6 58308087 missense probably benign 0.35
R0594:Vmn1r29 UTSW 6 58307772 missense probably benign 0.35
R0735:Vmn1r29 UTSW 6 58307732 missense probably damaging 0.96
R1476:Vmn1r29 UTSW 6 58307678 missense probably benign 0.23
R1679:Vmn1r29 UTSW 6 58308018 missense probably damaging 1.00
R1831:Vmn1r29 UTSW 6 58307707 nonsense probably null
R1925:Vmn1r29 UTSW 6 58308102 missense possibly damaging 0.79
R1933:Vmn1r29 UTSW 6 58307420 missense probably benign 0.03
R4582:Vmn1r29 UTSW 6 58308032 missense probably damaging 0.98
R4677:Vmn1r29 UTSW 6 58307300 missense probably benign 0.02
R4706:Vmn1r29 UTSW 6 58308151 missense probably benign 0.00
R5023:Vmn1r29 UTSW 6 58308067 nonsense probably null
R5542:Vmn1r29 UTSW 6 58308123 missense probably benign 0.14
R5649:Vmn1r29 UTSW 6 58307691 missense probably benign 0.13
R5656:Vmn1r29 UTSW 6 58308167 missense possibly damaging 0.94
R5906:Vmn1r29 UTSW 6 58307751 missense probably benign 0.19
R6078:Vmn1r29 UTSW 6 58308095 missense probably benign 0.01
R6349:Vmn1r29 UTSW 6 58307427 missense probably damaging 1.00
R7946:Vmn1r29 UTSW 6 58307849 missense probably benign 0.18
RF020:Vmn1r29 UTSW 6 58307543 missense probably benign 0.01
U15987:Vmn1r29 UTSW 6 58308095 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGTCACAATCAGTCCCAGTACC -3'
(R):5'- TGTGGGATAGGCACACATCACAAAC -3'

Sequencing Primer
(F):5'- CAGTACCTCACTGTTGGCAAAATTC -3'
(R):5'- GTCAGGACTACTGGGTCATACATC -3'
Posted On2014-03-14