Incidental Mutation 'R1422:Olfr564'
ID161122
Institutional Source Beutler Lab
Gene Symbol Olfr564
Ensembl Gene ENSMUSG00000048469
Gene Nameolfactory receptor 564
SynonymsGA_x6K02T2PBJ9-5513635-5514627, MOR14-10
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102803480-102804430 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102803850 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 124 (R124H)
Ref Sequence ENSEMBL: ENSMUSP00000129376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061096]
Predicted Effect probably benign
Transcript: ENSMUST00000061096
AA Change: R124H

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129376
Gene: ENSMUSG00000048469
AA Change: R124H

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.6e-117 PFAM
Pfam:7TM_GPCR_Srsx 38 256 4.7e-8 PFAM
Pfam:7tm_1 43 294 2.5e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Olfr564
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Olfr564 APN 7 102803854 nonsense probably null
IGL03248:Olfr564 APN 7 102803639 nonsense probably null
R1108:Olfr564 UTSW 7 102803850 missense probably benign 0.08
R1395:Olfr564 UTSW 7 102804207 missense possibly damaging 0.90
R4032:Olfr564 UTSW 7 102804189 missense probably benign 0.00
R5168:Olfr564 UTSW 7 102804321 missense probably benign
R5269:Olfr564 UTSW 7 102804120 missense probably benign
R5639:Olfr564 UTSW 7 102803993 missense probably benign
R5930:Olfr564 UTSW 7 102804274 missense probably damaging 1.00
R6019:Olfr564 UTSW 7 102804284 nonsense probably null
R7206:Olfr564 UTSW 7 102803684 missense probably damaging 1.00
R7254:Olfr564 UTSW 7 102803558 missense probably benign
R7845:Olfr564 UTSW 7 102804285 missense not run
R8036:Olfr564 UTSW 7 102803556 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TATGCAACTGCCCTGTCAGGGAAC -3'
(R):5'- AGTGATGAAGCACATGGCTGCTAC -3'

Sequencing Primer
(F):5'- TGTCAGGGAACAGCCTGATTC -3'
(R):5'- CATGGCTGCTACAGTAGGATAATC -3'
Posted On2014-03-14