Incidental Mutation 'R1422:Spock3'
ID161123
Institutional Source Beutler Lab
Gene Symbol Spock3
Ensembl Gene ENSMUSG00000054162
Gene Namesparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonymstestican 3, 2900045C01Rik
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location62951009-63357103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63143989 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 109 (I109T)
Ref Sequence ENSEMBL: ENSMUSP00000113797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093480] [ENSMUST00000117377] [ENSMUST00000118003] [ENSMUST00000119068]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093480
AA Change: I112T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091192
Gene: ENSMUSG00000054162
AA Change: I112T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 8.5e-35 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117377
AA Change: I109T

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113797
Gene: ENSMUSG00000054162
AA Change: I109T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 135 180 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 195 305 5e-35 PFAM
TY 335 381 2.27e-17 SMART
low complexity region 400 431 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118003
AA Change: I112T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113683
Gene: ENSMUSG00000054162
AA Change: I112T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 1.1e-36 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119068
AA Change: I112T

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112930
Gene: ENSMUSG00000054162
AA Change: I112T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 138 183 2.74e-11 SMART
Pfam:SPARC_Ca_bdg 198 308 8.5e-35 PFAM
TY 338 384 2.27e-17 SMART
low complexity region 403 434 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138398
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a novel family of calcium-binding proteoglycan proteins that contain thyroglobulin type-1 and Kazal-like domains. The encoded protein and may play a role in adult T-cell leukemia by inhibiting the activity of membrane-type matrix metalloproteinases. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious morphological or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Ift88 T C 14: 57,438,301 probably benign Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Spock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Spock3 APN 8 63348959 missense probably benign 0.01
IGL01716:Spock3 APN 8 63355350 missense unknown
IGL02058:Spock3 APN 8 63245198 nonsense probably null
IGL02450:Spock3 APN 8 63245215 critical splice donor site probably null
IGL02610:Spock3 APN 8 63345737 missense probably damaging 1.00
IGL03046:Spock3 UTSW 8 63348984 critical splice donor site probably null
R0044:Spock3 UTSW 8 63144007 missense possibly damaging 0.90
R0044:Spock3 UTSW 8 63144007 missense possibly damaging 0.90
R0084:Spock3 UTSW 8 63143929 missense probably damaging 1.00
R1469:Spock3 UTSW 8 62951900 missense probably damaging 0.99
R1469:Spock3 UTSW 8 62951900 missense probably damaging 0.99
R1484:Spock3 UTSW 8 63220705 missense probably damaging 1.00
R1728:Spock3 UTSW 8 63348977 missense probably damaging 0.99
R1729:Spock3 UTSW 8 63348977 missense probably damaging 0.99
R1739:Spock3 UTSW 8 63348947 missense probably damaging 0.99
R2057:Spock3 UTSW 8 63245170 nonsense probably null
R2340:Spock3 UTSW 8 63345713 missense probably damaging 1.00
R3732:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3732:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3733:Spock3 UTSW 8 63345699 missense probably damaging 1.00
R3763:Spock3 UTSW 8 63144015 critical splice donor site probably null
R5000:Spock3 UTSW 8 63245124 missense possibly damaging 0.86
R5069:Spock3 UTSW 8 63355265 missense probably benign 0.01
R5076:Spock3 UTSW 8 63345855 missense probably damaging 1.00
R5232:Spock3 UTSW 8 63345809 missense probably damaging 1.00
R5329:Spock3 UTSW 8 63345782 missense probably damaging 1.00
R5621:Spock3 UTSW 8 63144006 missense probably benign 0.19
R5882:Spock3 UTSW 8 63143931 missense probably benign 0.03
R5888:Spock3 UTSW 8 63355300 missense unknown
R5902:Spock3 UTSW 8 63355302 missense unknown
R6991:Spock3 UTSW 8 63355381 makesense probably null
R7317:Spock3 UTSW 8 63113556 missense possibly damaging 0.52
R7970:Spock3 UTSW 8 63345715 missense probably damaging 1.00
R8030:Spock3 UTSW 8 63352198 missense probably damaging 1.00
R8392:Spock3 UTSW 8 63355311 missense unknown
Predicted Primers PCR Primer
(F):5'- AAACTGTGAACCTGTCTGAGTTACAAGG -3'
(R):5'- ACTATATACCAACGCTTCTGGAGCCAT -3'

Sequencing Primer
(F):5'- CCTGTCTGAGTTACAAGGTTAGAAG -3'
(R):5'- ACGCTTCTGGAGCCATTTAAAC -3'
Posted On2014-03-14