Incidental Mutation 'R1422:Cpne4'
ID161128
Institutional Source Beutler Lab
Gene Symbol Cpne4
Ensembl Gene ENSMUSG00000032564
Gene Namecopine IV
Synonyms
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1422 (G1)
Quality Score206
Status Validated
Chromosome9
Chromosomal Location104547286-105034544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104900285 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 143 (I143T)
Ref Sequence ENSEMBL: ENSMUSP00000076432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057742] [ENSMUST00000077190] [ENSMUST00000213120] [ENSMUST00000213452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057742
AA Change: I143T

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049663
Gene: ENSMUSG00000032564
AA Change: I143T

DomainStartEndE-ValueType
C2 24 130 4.29e-6 SMART
C2 144 261 4.22e-5 SMART
low complexity region 269 279 N/A INTRINSIC
VWA 305 507 2.61e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077190
AA Change: I143T

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000076432
Gene: ENSMUSG00000032564
AA Change: I143T

DomainStartEndE-ValueType
C2 24 130 4.29e-6 SMART
C2 144 275 1.94e1 SMART
VWA 223 425 9.73e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213120
AA Change: I143T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000213452
Meta Mutation Damage Score 0.3585 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the highly conserved copine family. It encodes a calcium-dependent, phospholipid-binding protein, which may be involved in membrane trafficking, mitogenesis and development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Cpne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Cpne4 APN 9 104901511 missense probably damaging 1.00
IGL01871:Cpne4 APN 9 104925757 missense possibly damaging 0.93
IGL02097:Cpne4 APN 9 104686502 missense probably damaging 1.00
IGL02698:Cpne4 APN 9 105032785 missense probably damaging 1.00
IGL02933:Cpne4 APN 9 105019767 missense possibly damaging 0.64
R0471:Cpne4 UTSW 9 105022282 splice site probably null
R0528:Cpne4 UTSW 9 104686441 missense probably damaging 0.99
R0698:Cpne4 UTSW 9 104925795 missense probably damaging 1.00
R1025:Cpne4 UTSW 9 104993858 missense possibly damaging 0.64
R1054:Cpne4 UTSW 9 105022401 missense probably benign 0.01
R1300:Cpne4 UTSW 9 104993134 missense probably damaging 1.00
R1439:Cpne4 UTSW 9 104989632 missense probably damaging 0.99
R1634:Cpne4 UTSW 9 104989579 missense possibly damaging 0.94
R1777:Cpne4 UTSW 9 104872688 missense probably damaging 1.00
R2992:Cpne4 UTSW 9 105022365 missense probably damaging 1.00
R4094:Cpne4 UTSW 9 104686535 missense probably damaging 1.00
R4729:Cpne4 UTSW 9 104922556 missense probably damaging 0.96
R4943:Cpne4 UTSW 9 105019773 missense probably damaging 1.00
R5119:Cpne4 UTSW 9 104901521 splice site probably null
R5787:Cpne4 UTSW 9 105022401 missense probably benign 0.01
R5839:Cpne4 UTSW 9 104925828 missense probably damaging 1.00
R5876:Cpne4 UTSW 9 104925770 missense probably damaging 0.98
R7386:Cpne4 UTSW 9 104872740 missense possibly damaging 0.82
R7849:Cpne4 UTSW 9 104686519 missense probably damaging 0.99
R7887:Cpne4 UTSW 9 105032791 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGGTGAAGCATCTTGCAGAGGAG -3'
(R):5'- CACAAAGGAGCTGCATTTGGGC -3'

Sequencing Primer
(F):5'- GAATGGTTAAAGATAGACCTGAAGTC -3'
(R):5'- agaaagagagagagagagagagag -3'
Posted On2014-03-14