Incidental Mutation 'R1422:Fam184a'
ID161130
Institutional Source Beutler Lab
Gene Symbol Fam184a
Ensembl Gene ENSMUSG00000019856
Gene Namefamily with sequence similarity 184, member A
Synonyms4930438C08Rik, 4930589M24Rik, 3110012E06Rik
MMRRC Submission 039478-MU
Accession Numbers

Genbank: NM_001081428; MGI: 1923156

Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53633145-53751123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53675208 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 625 (M625K)
Ref Sequence ENSEMBL: ENSMUSP00000020003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020003] [ENSMUST00000163761] [ENSMUST00000171807] [ENSMUST00000218682]
Predicted Effect probably benign
Transcript: ENSMUST00000020003
AA Change: M625K

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020003
Gene: ENSMUSG00000019856
AA Change: M625K

DomainStartEndE-ValueType
Pfam:FAM184 57 267 1.5e-84 PFAM
low complexity region 436 449 N/A INTRINSIC
Blast:HisKA 533 598 4e-6 BLAST
coiled coil region 656 788 N/A INTRINSIC
internal_repeat_2 795 864 2.49e-6 PROSPERO
internal_repeat_1 800 866 4.75e-7 PROSPERO
coiled coil region 960 983 N/A INTRINSIC
low complexity region 1101 1113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163761
AA Change: M569K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127400
Gene: ENSMUSG00000019856
AA Change: M569K

DomainStartEndE-ValueType
coiled coil region 4 88 N/A INTRINSIC
internal_repeat_1 99 167 6.86e-8 PROSPERO
internal_repeat_2 105 173 4e-7 PROSPERO
low complexity region 380 393 N/A INTRINSIC
Blast:HisKA 480 542 5e-6 BLAST
coiled coil region 600 732 N/A INTRINSIC
internal_repeat_2 739 808 4e-7 PROSPERO
internal_repeat_1 744 810 6.86e-8 PROSPERO
low complexity region 906 916 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168949
Predicted Effect probably benign
Transcript: ENSMUST00000171807
AA Change: M221K

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130315
Gene: ENSMUSG00000019856
AA Change: M221K

DomainStartEndE-ValueType
low complexity region 32 45 N/A INTRINSIC
Pfam:DUF3090 64 159 5.9e-8 PFAM
low complexity region 303 343 N/A INTRINSIC
low complexity region 358 364 N/A INTRINSIC
internal_repeat_1 383 410 4.35e-5 PROSPERO
internal_repeat_1 424 451 4.35e-5 PROSPERO
low complexity region 648 660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218682
AA Change: M8K

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0738 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Fam184a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Fam184a APN 10 53694686 splice site probably benign
IGL01448:Fam184a APN 10 53698949 missense probably benign 0.19
IGL02052:Fam184a APN 10 53697120 unclassified probably benign
IGL02086:Fam184a APN 10 53699255 missense probably damaging 1.00
IGL02163:Fam184a APN 10 53647134 splice site probably null
IGL02247:Fam184a APN 10 53675160 missense probably damaging 1.00
IGL02316:Fam184a APN 10 53638239 missense probably damaging 1.00
IGL02493:Fam184a APN 10 53694693 critical splice donor site probably null
IGL02629:Fam184a APN 10 53698811 missense possibly damaging 0.80
IGL03006:Fam184a APN 10 53698697 missense probably damaging 1.00
2107:Fam184a UTSW 10 53641057 missense probably damaging 1.00
PIT4802001:Fam184a UTSW 10 53684354 nonsense probably null
R0427:Fam184a UTSW 10 53690115 missense probably damaging 1.00
R0477:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R0511:Fam184a UTSW 10 53698879 missense probably benign 0.03
R1322:Fam184a UTSW 10 53652319 missense probably damaging 1.00
R1474:Fam184a UTSW 10 53635365 missense probably damaging 0.99
R1752:Fam184a UTSW 10 53674570 missense probably benign 0.02
R1831:Fam184a UTSW 10 53647084 missense probably damaging 0.97
R2186:Fam184a UTSW 10 53638194 missense probably damaging 1.00
R2202:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2203:Fam184a UTSW 10 53652434 missense probably damaging 1.00
R2221:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2223:Fam184a UTSW 10 53655079 missense probably damaging 1.00
R2261:Fam184a UTSW 10 53647570 critical splice donor site probably null
R2444:Fam184a UTSW 10 53640949 missense probably damaging 1.00
R3876:Fam184a UTSW 10 53699061 missense probably damaging 1.00
R3932:Fam184a UTSW 10 53699301 missense probably damaging 0.99
R4685:Fam184a UTSW 10 53698500 missense probably benign 0.39
R4953:Fam184a UTSW 10 53698805 missense probably benign 0.00
R5056:Fam184a UTSW 10 53674574 missense probably damaging 1.00
R5420:Fam184a UTSW 10 53633657 missense probably damaging 0.99
R6159:Fam184a UTSW 10 53698773 missense probably damaging 1.00
R6554:Fam184a UTSW 10 53640967 missense possibly damaging 0.95
R6714:Fam184a UTSW 10 53698883 missense probably benign 0.00
R6966:Fam184a UTSW 10 53654999 missense probably benign 0.34
R7034:Fam184a UTSW 10 53694814 missense possibly damaging 0.71
R7237:Fam184a UTSW 10 53634393 unclassified probably benign
R7253:Fam184a UTSW 10 53698805 missense probably benign 0.00
R7359:Fam184a UTSW 10 53699222 missense probably damaging 1.00
R7449:Fam184a UTSW 10 53698634 missense probably damaging 0.98
R7479:Fam184a UTSW 10 53655014 missense probably benign 0.01
R7725:Fam184a UTSW 10 53633706 nonsense probably null
R7726:Fam184a UTSW 10 53633706 nonsense probably null
R7881:Fam184a UTSW 10 53698493 missense probably benign 0.00
R7886:Fam184a UTSW 10 53675160 missense probably damaging 1.00
R7896:Fam184a UTSW 10 53633706 nonsense probably null
R7897:Fam184a UTSW 10 53633706 nonsense probably null
R7937:Fam184a UTSW 10 53633706 nonsense probably null
R7943:Fam184a UTSW 10 53633706 nonsense probably null
R7943:Fam184a UTSW 10 53647041 missense probably damaging 1.00
R7970:Fam184a UTSW 10 53699325 missense probably damaging 1.00
R7972:Fam184a UTSW 10 53638259 missense probably damaging 1.00
R8049:Fam184a UTSW 10 53633706 nonsense probably null
Z1177:Fam184a UTSW 10 53699086 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAGTGCCATTGGGCTAACTTACAGG -3'
(R):5'- AGCAGGGGCATGTGGTTTCAAG -3'

Sequencing Primer
(F):5'- TGGTCCCTTGAGCAAGAATAC -3'
(R):5'- CATGTTGATTGTACACAGGTAGCC -3'
Posted On2014-03-14