Incidental Mutation 'R1422:Dtx3'
ID161133
Institutional Source Beutler Lab
Gene Symbol Dtx3
Ensembl Gene ENSMUSG00000040415
Gene Namedeltex 3, E3 ubiquitin ligase
Synonyms
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.412) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location127190378-127195728 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127191289 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 339 (I339F)
Ref Sequence ENSEMBL: ENSMUSP00000111937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019611] [ENSMUST00000038217] [ENSMUST00000116229] [ENSMUST00000130855] [ENSMUST00000137151] [ENSMUST00000144322] [ENSMUST00000167353] [ENSMUST00000218587] [ENSMUST00000218654] [ENSMUST00000222006] [ENSMUST00000219245]
Predicted Effect probably benign
Transcript: ENSMUST00000019611
SMART Domains Protein: ENSMUSP00000019611
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 146 171 N/A INTRINSIC
RhoGEF 203 374 2.45e-49 SMART
PH 394 507 6.67e-1 SMART
low complexity region 561 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038217
SMART Domains Protein: ENSMUSP00000044627
Gene: ENSMUSG00000040415

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116229
AA Change: I339F

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111937
Gene: ENSMUSG00000040415
AA Change: I339F

DomainStartEndE-ValueType
low complexity region 64 72 N/A INTRINSIC
coiled coil region 73 104 N/A INTRINSIC
low complexity region 119 154 N/A INTRINSIC
RING 164 202 1.04e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125254
Predicted Effect probably benign
Transcript: ENSMUST00000130855
SMART Domains Protein: ENSMUSP00000114776
Gene: ENSMUSG00000040415

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
low complexity region 122 157 N/A INTRINSIC
RING 167 205 1.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137151
Predicted Effect probably benign
Transcript: ENSMUST00000144322
SMART Domains Protein: ENSMUSP00000116510
Gene: ENSMUSG00000040415

DomainStartEndE-ValueType
low complexity region 67 75 N/A INTRINSIC
coiled coil region 76 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167353
SMART Domains Protein: ENSMUSP00000126339
Gene: ENSMUSG00000019467

DomainStartEndE-ValueType
low complexity region 72 94 N/A INTRINSIC
low complexity region 137 162 N/A INTRINSIC
RhoGEF 194 365 2.45e-49 SMART
PH 385 498 6.67e-1 SMART
low complexity region 552 560 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181578
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218478
Predicted Effect probably benign
Transcript: ENSMUST00000218587
Predicted Effect probably benign
Transcript: ENSMUST00000218654
Predicted Effect probably benign
Transcript: ENSMUST00000218864
Predicted Effect probably benign
Transcript: ENSMUST00000222006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219649
Predicted Effect probably benign
Transcript: ENSMUST00000219245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219079
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DTX3 functions as an E3 ubiquitin ligase (Takeyama et al., 2003 [PubMed 12670957]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Dtx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Dtx3 APN 10 127193279 missense probably damaging 0.99
IGL02314:Dtx3 APN 10 127190959 unclassified probably benign
R0257:Dtx3 UTSW 10 127192892 missense probably benign
R1108:Dtx3 UTSW 10 127191289 missense possibly damaging 0.84
R3693:Dtx3 UTSW 10 127191424 missense probably benign 0.33
R4016:Dtx3 UTSW 10 127191171 missense probably benign 0.00
R4231:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4232:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4236:Dtx3 UTSW 10 127193189 missense possibly damaging 0.92
R4590:Dtx3 UTSW 10 127192695 missense probably damaging 0.99
R4838:Dtx3 UTSW 10 127191307 splice site probably null
R5338:Dtx3 UTSW 10 127193050 missense probably benign 0.23
R5510:Dtx3 UTSW 10 127192938 missense probably benign 0.08
R6989:Dtx3 UTSW 10 127192877 missense probably benign 0.01
R7225:Dtx3 UTSW 10 127191489 missense probably damaging 0.99
R8137:Dtx3 UTSW 10 127193172 missense possibly damaging 0.85
R8293:Dtx3 UTSW 10 127191013 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCGTCTGTGATACCCTTGGCTC -3'
(R):5'- AAAGGCATTTGACCAGCGCCTC -3'

Sequencing Primer
(F):5'- CTTGCACCCTAGTCAGGTAG -3'
(R):5'- GACCAGCGCCTCACCTTC -3'
Posted On2014-03-14