Incidental Mutation 'R1422:Ctns'
ID161135
Institutional Source Beutler Lab
Gene Symbol Ctns
Ensembl Gene ENSMUSG00000005949
Gene Namecystinosis, nephropathic
Synonyms
MMRRC Submission 039478-MU
Accession Numbers

NCBI RefSeq: NM_031251; MGI: 1932872

Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73183596-73199042 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73185246 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 321 (Y321C)
Ref Sequence ENSEMBL: ENSMUSP00000104116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006103] [ENSMUST00000040687] [ENSMUST00000108476] [ENSMUST00000108477]
Predicted Effect probably damaging
Transcript: ENSMUST00000006103
AA Change: Y321C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006103
Gene: ENSMUSG00000005949
AA Change: Y321C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040687
SMART Domains Protein: ENSMUSP00000047410
Gene: ENSMUSG00000040158

DomainStartEndE-ValueType
PDZ 27 113 1.1e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108476
AA Change: Y321C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104116
Gene: ENSMUSG00000005949
AA Change: Y321C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108477
SMART Domains Protein: ENSMUSP00000104117
Gene: ENSMUSG00000040158

DomainStartEndE-ValueType
PDB:3DJ1|B 1 98 6e-63 PDB
SCOP:d1fc6a3 24 86 3e-7 SMART
Blast:PDZ 27 87 6e-33 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150407
Meta Mutation Damage Score 0.8788 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype Strain: MGI:2388945
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased intracellular cystine, progressive accumulation of cystine crystals, occasional muscle impairment, reduced exploratory activity, osteoporosis, and lowered electroretinogram amplitude. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Ctns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ctns APN 11 73188722 missense possibly damaging 0.88
IGL02582:Ctns APN 11 73196652 missense probably benign 0.22
R0103:Ctns UTSW 11 73185311 missense probably damaging 1.00
R1125:Ctns UTSW 11 73187837 critical splice acceptor site probably null
R1333:Ctns UTSW 11 73184997 missense probably benign 0.03
R1621:Ctns UTSW 11 73188472 missense possibly damaging 0.72
R2104:Ctns UTSW 11 73193081 missense probably benign 0.07
R2427:Ctns UTSW 11 73196686 missense probably damaging 1.00
R4096:Ctns UTSW 11 73186386 missense probably benign 0.11
R4946:Ctns UTSW 11 73196653 missense probably benign
R6220:Ctns UTSW 11 73193128 missense probably benign 0.00
R6307:Ctns UTSW 11 73191733 missense probably benign 0.26
R6744:Ctns UTSW 11 73185285 missense probably damaging 1.00
R7064:Ctns UTSW 11 73186392 missense probably benign 0.19
R7402:Ctns UTSW 11 73193077 missense possibly damaging 0.51
R7583:Ctns UTSW 11 73188470 missense probably benign 0.44
R8071:Ctns UTSW 11 73184934 missense probably damaging 1.00
R8072:Ctns UTSW 11 73191746 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGATACAACCTTTCCTACCAGGGC -3'
(R):5'- TTTGGAGTACCAGTCACAGGCGTG -3'

Sequencing Primer
(F):5'- GGGTCTCCGAAGATCAATGTC -3'
(R):5'- TGTGTGCTTCTGTCTGGC -3'
Posted On2014-03-14