Incidental Mutation 'R1422:Becn1'
ID161136
Institutional Source Beutler Lab
Gene Symbol Becn1
Ensembl Gene ENSMUSG00000035086
Gene Namebeclin 1, autophagy related
SynonymsAtg6
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location101285952-101302286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101295126 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 98 (D98G)
Ref Sequence ENSEMBL: ENSMUSP00000129156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041403] [ENSMUST00000126195] [ENSMUST00000129863] [ENSMUST00000130916] [ENSMUST00000140706] [ENSMUST00000172233] [ENSMUST00000167667] [ENSMUST00000167818] [ENSMUST00000170502]
Predicted Effect probably benign
Transcript: ENSMUST00000041403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122817
Predicted Effect probably benign
Transcript: ENSMUST00000126195
AA Change: D106G

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122168
Gene: ENSMUSG00000035086
AA Change: D106G

DomainStartEndE-ValueType
Pfam:BH3 35 59 5.6e-22 PFAM
Pfam:APG6 65 147 1.8e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129863
SMART Domains Protein: ENSMUSP00000116580
Gene: ENSMUSG00000035086

DomainStartEndE-ValueType
Pfam:APG6 6 125 1.5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130916
AA Change: D174G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000119369
Gene: ENSMUSG00000035086
AA Change: D174G

DomainStartEndE-ValueType
Pfam:BH3 103 127 4.1e-20 PFAM
Pfam:APG6 133 444 1.1e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139997
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140286
Predicted Effect probably benign
Transcript: ENSMUST00000140706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153438
Predicted Effect possibly damaging
Transcript: ENSMUST00000172233
AA Change: D98G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129156
Gene: ENSMUSG00000035086
AA Change: D98G

DomainStartEndE-ValueType
Pfam:APG6 79 274 3.7e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164036
Predicted Effect probably benign
Transcript: ENSMUST00000167667
Predicted Effect probably benign
Transcript: ENSMUST00000167818
Predicted Effect probably benign
Transcript: ENSMUST00000170502
Meta Mutation Damage Score 0.1326 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates autophagy, a catabolic process of degradation induced by starvation. The encoded protein is a component of the phosphatidylinositol-3-kinase (PI3K) complex which mediates vesicle-trafficking processes. This protein is thought to play a role in multiple cellular processes, including tumorigenesis, neurodegeneration and apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit premature death, increased tumor incidence and reduced autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Ift88 T C 14: 57,438,301 probably benign Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Becn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Becn1 APN 11 101295622 missense probably benign 0.39
IGL01296:Becn1 APN 11 101291451 missense probably damaging 1.00
IGL01303:Becn1 APN 11 101294985 missense possibly damaging 0.92
IGL01311:Becn1 APN 11 101291516 missense probably damaging 1.00
IGL02269:Becn1 APN 11 101291535 splice site probably benign
IGL02472:Becn1 APN 11 101291398 missense probably benign 0.03
indisposed UTSW 11 101291510 missense probably damaging 1.00
R0123:Becn1 UTSW 11 101290498 missense probably damaging 1.00
R0147:Becn1 UTSW 11 101301736 missense probably damaging 1.00
R0453:Becn1 UTSW 11 101290449 missense probably damaging 1.00
R1840:Becn1 UTSW 11 101295566 missense probably damaging 1.00
R4097:Becn1 UTSW 11 101294266 intron probably benign
R5041:Becn1 UTSW 11 101288836 missense probably benign 0.30
R5119:Becn1 UTSW 11 101291395 missense probably damaging 1.00
R5319:Becn1 UTSW 11 101288803 utr 3 prime probably benign
R5602:Becn1 UTSW 11 101288952 missense probably damaging 1.00
R6178:Becn1 UTSW 11 101291510 missense probably damaging 1.00
R6190:Becn1 UTSW 11 101295374 missense probably damaging 1.00
R7076:Becn1 UTSW 11 101295324 missense probably benign
R7438:Becn1 UTSW 11 101294226 missense probably benign 0.00
R7831:Becn1 UTSW 11 101290453 missense probably benign 0.00
R8220:Becn1 UTSW 11 101296279 missense possibly damaging 0.95
X0011:Becn1 UTSW 11 101289822 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGGCAAGTGTGTTTTCAGAGCCC -3'
(R):5'- CTGGACACTCAGCTCAATGTCACTG -3'

Sequencing Primer
(F):5'- GGAGCAGACATTATACTACTGCCTG -3'
(R):5'- CTCAGCTCAATGTCACTGAGAATG -3'
Posted On2014-03-14