Incidental Mutation 'R1422:Kif19a'
ID161137
Institutional Source Beutler Lab
Gene Symbol Kif19a
Ensembl Gene ENSMUSG00000010021
Gene Namekinesin family member 19A
SynonymsN-8 kinesin
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location114765388-114790739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114785809 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 488 (D488G)
Ref Sequence ENSEMBL: ENSMUSP00000081398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084368] [ENSMUST00000138804]
Predicted Effect probably benign
Transcript: ENSMUST00000084368
AA Change: D488G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000081398
Gene: ENSMUSG00000010021
AA Change: D488G

DomainStartEndE-ValueType
KISc 9 354 4.53e-150 SMART
coiled coil region 361 388 N/A INTRINSIC
coiled coil region 431 449 N/A INTRINSIC
coiled coil region 506 551 N/A INTRINSIC
low complexity region 628 641 N/A INTRINSIC
low complexity region 750 766 N/A INTRINSIC
low complexity region 807 815 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137326
Predicted Effect probably benign
Transcript: ENSMUST00000138340
SMART Domains Protein: ENSMUSP00000122743
Gene: ENSMUSG00000010021

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 79 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138804
AA Change: D446G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115663
Gene: ENSMUSG00000010021
AA Change: D446G

DomainStartEndE-ValueType
KISc 9 312 2.99e-118 SMART
coiled coil region 319 346 N/A INTRINSIC
coiled coil region 389 407 N/A INTRINSIC
coiled coil region 464 509 N/A INTRINSIC
low complexity region 586 599 N/A INTRINSIC
low complexity region 683 692 N/A INTRINSIC
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display partial postnatal lethality, hydroencephaly, female infertility, oviduct obstruction, increased motile cilium length and impaired motile cilium movement. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Ift88 T C 14: 57,438,301 probably benign Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Kif19a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Kif19a APN 11 114779585 missense probably damaging 1.00
IGL00743:Kif19a APN 11 114784773 missense probably damaging 1.00
IGL00763:Kif19a APN 11 114767168 missense probably benign 0.00
IGL01327:Kif19a APN 11 114781799 splice site probably benign
IGL02422:Kif19a APN 11 114789361 missense probably damaging 1.00
IGL02481:Kif19a APN 11 114789153 missense probably benign 0.28
IGL02496:Kif19a APN 11 114779644 missense probably damaging 0.99
IGL02735:Kif19a APN 11 114785567 missense probably damaging 1.00
IGL02830:Kif19a APN 11 114781208 missense probably damaging 1.00
IGL02902:Kif19a APN 11 114785570 missense possibly damaging 0.46
IGL03372:Kif19a APN 11 114779218 missense probably damaging 0.99
PIT4520001:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R0212:Kif19a UTSW 11 114784910 missense possibly damaging 0.48
R0383:Kif19a UTSW 11 114765514 start codon destroyed possibly damaging 0.63
R0850:Kif19a UTSW 11 114780787 missense probably damaging 0.99
R1343:Kif19a UTSW 11 114785827 missense probably benign 0.08
R1547:Kif19a UTSW 11 114786572 missense probably benign 0.41
R1591:Kif19a UTSW 11 114789231 missense probably benign
R2148:Kif19a UTSW 11 114780768 missense probably damaging 1.00
R2291:Kif19a UTSW 11 114790193 missense probably damaging 1.00
R3814:Kif19a UTSW 11 114781919 missense probably damaging 1.00
R3944:Kif19a UTSW 11 114786735 missense probably benign 0.34
R4631:Kif19a UTSW 11 114784847 missense possibly damaging 0.95
R4866:Kif19a UTSW 11 114767227 missense probably benign 0.00
R4867:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5022:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5071:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5072:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5073:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5074:Kif19a UTSW 11 114767227 missense probably benign 0.00
R5091:Kif19a UTSW 11 114783097 missense probably damaging 1.00
R5640:Kif19a UTSW 11 114779215 missense probably benign 0.25
R5646:Kif19a UTSW 11 114779654 missense probably damaging 1.00
R5786:Kif19a UTSW 11 114779223 nonsense probably null
R5890:Kif19a UTSW 11 114789438 missense possibly damaging 0.92
R6344:Kif19a UTSW 11 114781951 critical splice donor site probably null
R6522:Kif19a UTSW 11 114785779 missense probably damaging 1.00
R6570:Kif19a UTSW 11 114784905 missense possibly damaging 0.63
R6879:Kif19a UTSW 11 114781333 missense probably benign 0.03
R7028:Kif19a UTSW 11 114781208 missense probably damaging 1.00
R7274:Kif19a UTSW 11 114765455 start gained probably benign
R7492:Kif19a UTSW 11 114790239 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TTCCACGAGCAGATGGATGTGC -3'
(R):5'- AGATGTAGAGACCTGGACACCCAAG -3'

Sequencing Primer
(F):5'- TGGAAGTCCAGATTGACACCTC -3'
(R):5'- tctccctcttcccagcc -3'
Posted On2014-03-14