Incidental Mutation 'R1422:Arhgap5'
ID161138
Institutional Source Beutler Lab
Gene Symbol Arhgap5
Ensembl Gene ENSMUSG00000035133
Gene NameRho GTPase activating protein 5
Synonymsp190B, p190-B
MMRRC Submission 039478-MU
Accession Numbers

Genbank: NM_009706; MGI: 1332637

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location52503972-52571975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52519514 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1089 (D1089E)
Ref Sequence ENSEMBL: ENSMUSP00000151809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]
Predicted Effect probably damaging
Transcript: ENSMUST00000110725
AA Change: D1089E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: D1089E

DomainStartEndE-ValueType
Pfam:Ras 142 248 5.3e-7 PFAM
FF 269 325 6.03e-12 SMART
FF 367 420 4.61e-8 SMART
FF 427 482 2.22e-10 SMART
FF 483 537 3.89e-6 SMART
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1224 1247 N/A INTRINSIC
RhoGAP 1273 1447 1.03e-73 SMART
low complexity region 1479 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218869
Predicted Effect probably damaging
Transcript: ENSMUST00000219443
AA Change: D1089E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4167 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Arhgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Arhgap5 APN 12 52517281 missense probably damaging 0.98
IGL00823:Arhgap5 APN 12 52518742 missense possibly damaging 0.84
IGL01161:Arhgap5 APN 12 52516860 missense probably damaging 1.00
IGL01360:Arhgap5 APN 12 52518240 missense probably damaging 1.00
IGL01910:Arhgap5 APN 12 52516861 missense probably benign 0.33
IGL02417:Arhgap5 APN 12 52518353 missense probably damaging 0.99
IGL02448:Arhgap5 APN 12 52562340 missense probably damaging 0.97
IGL02813:Arhgap5 APN 12 52516965 missense probably benign 0.20
IGL03398:Arhgap5 APN 12 52517311 missense probably damaging 0.99
Decline UTSW 12 52516582 nonsense probably null
Pass UTSW 12 52516507 missense possibly damaging 0.82
3-1:Arhgap5 UTSW 12 52518882 missense possibly damaging 0.54
R0039:Arhgap5 UTSW 12 52518735 nonsense probably null
R0088:Arhgap5 UTSW 12 52516548 missense probably damaging 1.00
R0104:Arhgap5 UTSW 12 52516717 missense probably damaging 1.00
R0111:Arhgap5 UTSW 12 52559960 splice site probably benign
R0356:Arhgap5 UTSW 12 52516308 missense probably damaging 1.00
R0616:Arhgap5 UTSW 12 52517065 missense possibly damaging 0.79
R0707:Arhgap5 UTSW 12 52518168 missense probably damaging 1.00
R0718:Arhgap5 UTSW 12 52516507 missense possibly damaging 0.82
R0849:Arhgap5 UTSW 12 52519623 missense probably benign 0.01
R0975:Arhgap5 UTSW 12 52517144 missense possibly damaging 0.61
R1326:Arhgap5 UTSW 12 52518370 missense possibly damaging 0.80
R1421:Arhgap5 UTSW 12 52516848 missense probably damaging 1.00
R1625:Arhgap5 UTSW 12 52517376 missense probably benign
R1711:Arhgap5 UTSW 12 52519345 missense probably damaging 1.00
R1970:Arhgap5 UTSW 12 52542593 missense probably damaging 1.00
R2004:Arhgap5 UTSW 12 52518034 missense probably benign 0.05
R2356:Arhgap5 UTSW 12 52519147 missense probably benign 0.00
R3792:Arhgap5 UTSW 12 52519888 missense probably benign 0.21
R3808:Arhgap5 UTSW 12 52567187 missense possibly damaging 0.72
R4458:Arhgap5 UTSW 12 52517957 missense probably benign
R4703:Arhgap5 UTSW 12 52517583 missense probably damaging 0.99
R4736:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4737:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4740:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4768:Arhgap5 UTSW 12 52557492 missense probably damaging 1.00
R4806:Arhgap5 UTSW 12 52518703 missense probably damaging 0.99
R4817:Arhgap5 UTSW 12 52519209 missense possibly damaging 0.71
R5586:Arhgap5 UTSW 12 52519912 missense possibly damaging 0.95
R5681:Arhgap5 UTSW 12 52519779 missense probably benign 0.21
R5683:Arhgap5 UTSW 12 52519586 missense probably benign
R5911:Arhgap5 UTSW 12 52518742 missense possibly damaging 0.84
R6448:Arhgap5 UTSW 12 52517663 missense probably benign 0.11
R6887:Arhgap5 UTSW 12 52519144 missense probably benign
R6988:Arhgap5 UTSW 12 52518125 missense possibly damaging 0.94
R7009:Arhgap5 UTSW 12 52519639 missense probably benign 0.03
R7013:Arhgap5 UTSW 12 52518326 missense probably benign 0.05
R7239:Arhgap5 UTSW 12 52517376 missense probably benign
R7310:Arhgap5 UTSW 12 52542487 critical splice acceptor site probably null
R7339:Arhgap5 UTSW 12 52517698 missense possibly damaging 0.64
R7375:Arhgap5 UTSW 12 52516582 nonsense probably null
R7421:Arhgap5 UTSW 12 52518000 missense probably benign 0.42
R7442:Arhgap5 UTSW 12 52516956 missense probably benign 0.25
R7842:Arhgap5 UTSW 12 52518697 missense possibly damaging 0.78
R7925:Arhgap5 UTSW 12 52518697 missense possibly damaging 0.78
X0018:Arhgap5 UTSW 12 52518397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAACACCTAGTGACCGTTCCAG -3'
(R):5'- GAAAGCCTCATCATCGCTTGCATC -3'

Sequencing Primer
(F):5'- CTAGTGACCGTTCCAGATACAGG -3'
(R):5'- CATCGCTTGCATCTGAGTGTG -3'
Posted On2014-03-14