Incidental Mutation 'R1422:Zfp366'
ID161140
Institutional Source Beutler Lab
Gene Symbol Zfp366
Ensembl Gene ENSMUSG00000050919
Gene Namezinc finger protein 366
SynonymsDC-SCRIPT
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R1422 (G1)
Quality Score168
Status Validated
Chromosome13
Chromosomal Location99184823-99250656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99229296 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 322 (K322E)
Ref Sequence ENSEMBL: ENSMUSP00000060040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056558]
Predicted Effect probably damaging
Transcript: ENSMUST00000056558
AA Change: K322E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060040
Gene: ENSMUSG00000050919
AA Change: K322E

DomainStartEndE-ValueType
low complexity region 159 175 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
ZnF_C2H2 250 272 1.18e-2 SMART
ZnF_C2H2 278 300 4.05e-1 SMART
ZnF_C2H2 306 328 1.79e-2 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 362 384 1.89e-1 SMART
ZnF_C2H2 390 412 1.22e-4 SMART
ZnF_C2H2 418 440 1.36e-2 SMART
ZnF_C2H2 446 468 1.1e-2 SMART
ZnF_C2H2 474 496 8.34e-3 SMART
ZnF_C2H2 502 524 5.42e-2 SMART
ZnF_C2H2 530 553 2.4e-3 SMART
low complexity region 615 623 N/A INTRINSIC
Meta Mutation Damage Score 0.2128 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit perimembranous and muscular ventricular septal defects (VSD), and overriding aorta. Short snout, micrognathia, micropthalmia, hypoplastic thymus, and hydronephrosis are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Other mutations in Zfp366
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Zfp366 APN 13 99246572 utr 3 prime probably benign
IGL01626:Zfp366 APN 13 99228412 missense probably damaging 0.99
IGL02227:Zfp366 APN 13 99234188 missense possibly damaging 0.85
IGL03074:Zfp366 APN 13 99246405 missense probably benign
R0126:Zfp366 UTSW 13 99228621 missense probably benign 0.14
R0145:Zfp366 UTSW 13 99229540 missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99234260 missense probably damaging 1.00
R0234:Zfp366 UTSW 13 99234260 missense probably damaging 1.00
R0376:Zfp366 UTSW 13 99234251 missense probably benign 0.00
R0537:Zfp366 UTSW 13 99229278 missense probably damaging 1.00
R0637:Zfp366 UTSW 13 99228966 missense probably damaging 0.99
R0838:Zfp366 UTSW 13 99228610 missense possibly damaging 0.73
R1386:Zfp366 UTSW 13 99246555 missense probably damaging 0.98
R1669:Zfp366 UTSW 13 99229561 missense probably damaging 0.99
R1839:Zfp366 UTSW 13 99228492 missense probably damaging 0.98
R3751:Zfp366 UTSW 13 99228844 missense probably damaging 1.00
R4782:Zfp366 UTSW 13 99246483 missense probably damaging 1.00
R4908:Zfp366 UTSW 13 99234101 missense possibly damaging 0.68
R4992:Zfp366 UTSW 13 99229495 missense possibly damaging 0.62
R5040:Zfp366 UTSW 13 99228367 missense probably damaging 1.00
R5086:Zfp366 UTSW 13 99228943 missense probably benign 0.00
R5186:Zfp366 UTSW 13 99246168 missense probably benign 0.00
R5249:Zfp366 UTSW 13 99229609 missense probably damaging 1.00
R5450:Zfp366 UTSW 13 99229585 missense probably damaging 1.00
R6838:Zfp366 UTSW 13 99228507 missense possibly damaging 0.93
R6838:Zfp366 UTSW 13 99246177 missense possibly damaging 0.83
R7250:Zfp366 UTSW 13 99229568 missense probably damaging 1.00
R7378:Zfp366 UTSW 13 99229515 missense probably damaging 1.00
R7571:Zfp366 UTSW 13 99246387 missense probably benign 0.03
R7624:Zfp366 UTSW 13 99246296 missense probably benign
R7653:Zfp366 UTSW 13 99229201 missense probably damaging 1.00
R8367:Zfp366 UTSW 13 99244043 missense possibly damaging 0.95
Z1176:Zfp366 UTSW 13 99246350 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGCCCCACCTGTGAAAAGTC -3'
(R):5'- CACTCCGAGCAGTTGTACTGGATG -3'

Sequencing Primer
(F):5'- TCCAAGTACAACCTGGTGAC -3'
(R):5'- CACACAAATGTTTTCGCGCC -3'
Posted On2014-03-14