Incidental Mutation 'R1422:Mmrn2'
ID161143
Institutional Source Beutler Lab
Gene Symbol Mmrn2
Ensembl Gene ENSMUSG00000041445
Gene Namemultimerin 2
SynonymsEmilin3, EndoGlyx-1, ENDOGLYX1
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R1422 (G1)
Quality Score204
Status Validated
Chromosome14
Chromosomal Location34375465-34404287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34396239 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 80 (H80R)
Ref Sequence ENSEMBL: ENSMUSP00000107539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111908]
Predicted Effect probably damaging
Transcript: ENSMUST00000111908
AA Change: H80R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107539
Gene: ENSMUSG00000041445
AA Change: H80R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 55 127 1.1e-15 PFAM
low complexity region 174 186 N/A INTRINSIC
low complexity region 356 362 N/A INTRINSIC
coiled coil region 387 480 N/A INTRINSIC
coiled coil region 533 583 N/A INTRINSIC
coiled coil region 688 715 N/A INTRINSIC
Pfam:C1q 821 940 1.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227130
Meta Mutation Damage Score 0.0923 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transforming growth factor beta antagonist and can interfere with the VEGF-A/VEGFR2 pathway. A related pseudogene has been identified on chromosome 6. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Mmrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Mmrn2 APN 14 34403217 missense probably damaging 1.00
IGL02529:Mmrn2 APN 14 34398613 missense possibly damaging 0.74
IGL02590:Mmrn2 APN 14 34399267 nonsense probably null
P0037:Mmrn2 UTSW 14 34403065 missense probably damaging 1.00
R0323:Mmrn2 UTSW 14 34398034 missense probably damaging 0.97
R0499:Mmrn2 UTSW 14 34397956 missense probably damaging 1.00
R1073:Mmrn2 UTSW 14 34396294 critical splice donor site probably null
R1455:Mmrn2 UTSW 14 34399132 missense probably benign 0.00
R1584:Mmrn2 UTSW 14 34375685 missense probably benign 0.19
R1702:Mmrn2 UTSW 14 34397914 missense probably benign 0.34
R1919:Mmrn2 UTSW 14 34397643 missense probably benign 0.10
R1961:Mmrn2 UTSW 14 34398475 splice site probably null
R2267:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2268:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2516:Mmrn2 UTSW 14 34398802 missense probably benign 0.12
R2571:Mmrn2 UTSW 14 34402939 missense probably damaging 0.99
R2696:Mmrn2 UTSW 14 34398415 missense probably damaging 1.00
R2892:Mmrn2 UTSW 14 34396630 missense probably benign 0.01
R2919:Mmrn2 UTSW 14 34402922 missense possibly damaging 0.72
R3611:Mmrn2 UTSW 14 34398675 missense probably benign 0.00
R3898:Mmrn2 UTSW 14 34399560 splice site probably null
R3899:Mmrn2 UTSW 14 34399560 splice site probably null
R3900:Mmrn2 UTSW 14 34399560 splice site probably null
R4363:Mmrn2 UTSW 14 34397977 missense probably damaging 0.99
R4392:Mmrn2 UTSW 14 34397616 missense probably damaging 1.00
R4510:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4511:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4993:Mmrn2 UTSW 14 34396398 missense probably damaging 1.00
R5026:Mmrn2 UTSW 14 34399201 missense probably benign 0.07
R5263:Mmrn2 UTSW 14 34399584 missense probably benign
R5478:Mmrn2 UTSW 14 34396582 missense probably benign 0.11
R5606:Mmrn2 UTSW 14 34397624 missense probably damaging 1.00
R6059:Mmrn2 UTSW 14 34397591 nonsense probably null
R6279:Mmrn2 UTSW 14 34397657 missense probably benign
R6300:Mmrn2 UTSW 14 34397657 missense probably benign
R6938:Mmrn2 UTSW 14 34398714 missense probably benign 0.22
R7491:Mmrn2 UTSW 14 34399417 missense probably damaging 1.00
R7607:Mmrn2 UTSW 14 34398940 missense possibly damaging 0.58
R7979:Mmrn2 UTSW 14 34396181 nonsense probably null
R7999:Mmrn2 UTSW 14 34397922 missense probably benign 0.30
R8113:Mmrn2 UTSW 14 34397636 missense probably benign 0.39
X0064:Mmrn2 UTSW 14 34399152 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTGGCTTTGGGAAGACAATGAATG -3'
(R):5'- AGAGATCAGCACCTTCTGCTGGAC -3'

Sequencing Primer
(F):5'- GGTTTCAAGAATCTCAGAGCTG -3'
(R):5'- GACCTGGTACACTGGCTTCTG -3'
Posted On2014-03-14