Incidental Mutation 'R1422:Cyp4f16'
ID161147
Institutional Source Beutler Lab
Gene Symbol Cyp4f16
Ensembl Gene ENSMUSG00000048440
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 16
Synonyms
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1422 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32536558-32551798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32542999 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 174 (M174L)
Ref Sequence ENSEMBL: ENSMUSP00000131058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003416] [ENSMUST00000165515] [ENSMUST00000169252] [ENSMUST00000169591]
Predicted Effect probably damaging
Transcript: ENSMUST00000003416
AA Change: M174L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003416
Gene: ENSMUSG00000048440
AA Change: M174L

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164628
Predicted Effect probably benign
Transcript: ENSMUST00000165515
SMART Domains Protein: ENSMUSP00000126845
Gene: ENSMUSG00000048440

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168346
Predicted Effect probably benign
Transcript: ENSMUST00000169252
SMART Domains Protein: ENSMUSP00000128349
Gene: ENSMUSG00000048440

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169591
AA Change: M174L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131058
Gene: ENSMUSG00000048440
AA Change: M174L

DomainStartEndE-ValueType
Pfam:p450 52 515 4.7e-133 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170956
Meta Mutation Damage Score 0.5720 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Cyp4f16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02941:Cyp4f16 APN 17 32537087 missense possibly damaging 0.75
IGL03400:Cyp4f16 APN 17 32550353 missense probably benign 0.00
R0437:Cyp4f16 UTSW 17 32537098 missense possibly damaging 0.46
R0454:Cyp4f16 UTSW 17 32537087 missense probably damaging 0.97
R0482:Cyp4f16 UTSW 17 32550551 missense probably damaging 1.00
R1435:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1440:Cyp4f16 UTSW 17 32550734 nonsense probably null
R1616:Cyp4f16 UTSW 17 32542968 nonsense probably null
R1840:Cyp4f16 UTSW 17 32543006 critical splice donor site probably null
R1854:Cyp4f16 UTSW 17 32537099 missense probably damaging 0.99
R1912:Cyp4f16 UTSW 17 32545044 missense probably damaging 0.99
R2200:Cyp4f16 UTSW 17 32537104 missense probably damaging 0.98
R3803:Cyp4f16 UTSW 17 32544884 missense possibly damaging 0.96
R4811:Cyp4f16 UTSW 17 32545106 missense probably benign
R4812:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R4837:Cyp4f16 UTSW 17 32542764 missense possibly damaging 0.59
R4867:Cyp4f16 UTSW 17 32550750 missense possibly damaging 0.94
R4909:Cyp4f16 UTSW 17 32550321 missense possibly damaging 0.46
R5857:Cyp4f16 UTSW 17 32537024 missense probably damaging 1.00
R5986:Cyp4f16 UTSW 17 32544142 missense probably benign 0.45
R6013:Cyp4f16 UTSW 17 32546678 missense probably null 1.00
R6408:Cyp4f16 UTSW 17 32551199 missense probably damaging 1.00
R6651:Cyp4f16 UTSW 17 32544144 missense probably benign 0.00
R7463:Cyp4f16 UTSW 17 32550787 missense possibly damaging 0.89
R7923:Cyp4f16 UTSW 17 32546747 missense possibly damaging 0.67
RF005:Cyp4f16 UTSW 17 32545195 splice site probably null
X0017:Cyp4f16 UTSW 17 32544936 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGAATTTTCCACCTTTGTCCACTG -3'
(R):5'- ACTTGACAACCAGAGTGAACTCAGC -3'

Sequencing Primer
(F):5'- GACATTACTGCCCTCCCAGG -3'
(R):5'- tccccaggcaggtagtaag -3'
Posted On2014-03-14