Incidental Mutation 'R1422:Gm14685'
ID161153
Institutional Source Beutler Lab
Gene Symbol Gm14685
Ensembl Gene ENSMUSG00000067771
Gene Namepredicted gene 14685
Synonyms
MMRRC Submission 039478-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1422 (G1)
Quality Score181
Status Validated
ChromosomeX
Chromosomal Location73117047-73129262 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 73127655 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 218 (G218C)
Ref Sequence ENSEMBL: ENSMUSP00000137311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088459] [ENSMUST00000179117] [ENSMUST00000179600]
Predicted Effect probably damaging
Transcript: ENSMUST00000088459
AA Change: G218C

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000085806
Gene: ENSMUSG00000067771
AA Change: G218C

DomainStartEndE-ValueType
PDB:3PMI|D 377 508 2e-35 PDB
low complexity region 675 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179117
AA Change: G218C

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000137311
Gene: ENSMUSG00000067771
AA Change: G218C

DomainStartEndE-ValueType
PDB:3PMI|D 377 508 2e-35 PDB
low complexity region 675 688 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179600
SMART Domains Protein: ENSMUSP00000137006
Gene: ENSMUSG00000058328

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
Pfam:Cor1 76 204 7.4e-24 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.2%
  • 20x: 89.6%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik A G 18: 24,477,276 T170A probably benign Het
3110002H16Rik G A 18: 12,181,623 D87N probably damaging Het
4931408C20Rik C G 1: 26,682,466 S1211T possibly damaging Het
Arhgap5 T A 12: 52,519,514 D1089E probably damaging Het
Atrn T C 2: 130,957,914 Y404H probably damaging Het
Becn1 T C 11: 101,295,126 D98G possibly damaging Het
Coro2b A G 9: 62,428,947 probably null Het
Cpne4 T C 9: 104,900,285 I143T probably damaging Het
Cr2 A G 1: 195,171,125 I35T probably benign Het
Ctns T C 11: 73,185,246 Y321C probably damaging Het
Cyp4f16 A T 17: 32,542,999 M174L probably damaging Het
Dpy19l4 T C 4: 11,317,168 E10G possibly damaging Het
Dtx3 T A 10: 127,191,289 I339F possibly damaging Het
Fam184a A T 10: 53,675,208 M625K probably benign Het
Fgd6 A G 10: 94,045,372 E696G probably damaging Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gria1 T A 11: 57,189,788 L199Q probably benign Het
Hk1 T C 10: 62,296,094 D184G probably null Het
Ift88 T C 14: 57,438,301 probably benign Het
Ift88 G A 14: 57,472,979 V403M probably damaging Het
Igsf1 C A X: 49,782,936 G737* probably null Het
Kif19a A G 11: 114,785,809 D488G probably benign Het
Lpcat2 T C 8: 92,879,417 L232P probably damaging Het
Ly9 A G 1: 171,601,212 V280A probably damaging Het
Macrod2 T A 2: 140,419,941 probably null Het
Mmp1a A G 9: 7,464,298 probably null Het
Mmrn2 A G 14: 34,396,239 H80R probably damaging Het
Olfr1156 G A 2: 87,950,095 T46I probably benign Het
Olfr124 T C 17: 37,805,363 Y73H probably damaging Het
Olfr564 G A 7: 102,803,850 R124H probably benign Het
Pkd1l3 C A 8: 109,621,708 P194H unknown Het
Plk2 A G 13: 110,399,489 M576V probably damaging Het
Pms2 T A 5: 143,913,705 S113T probably damaging Het
Ptprk A G 10: 28,475,280 I590V possibly damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rad17 A G 13: 100,645,082 L69P probably benign Het
Robo2 G A 16: 73,978,448 T466M probably damaging Het
Sema6a A G 18: 47,306,431 C9R probably benign Het
Slc6a19 A G 13: 73,685,869 S357P probably benign Het
Spock3 T C 8: 63,143,989 I109T possibly damaging Het
Svs6 T C 2: 164,317,660 probably null Het
Tenm4 A T 7: 96,550,051 D17V probably damaging Het
Trp53bp2 T A 1: 182,446,464 M558K probably benign Het
Ttn T C 2: 76,741,670 E26293G probably damaging Het
Vmn1r29 A G 6: 58,307,886 Y197C probably damaging Het
Wdfy3 A T 5: 101,884,214 probably benign Het
Zfp366 A G 13: 99,229,296 K322E probably damaging Het
Other mutations in Gm14685
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1162:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1178:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1416:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1498:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1520:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1544:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1674:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1774:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1888:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1888:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1984:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R1999:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R2025:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R2026:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R2054:Gm14685 UTSW X 73127655 missense probably damaging 0.97
R5068:Gm14685 UTSW X 73127971 missense probably damaging 0.99
R5069:Gm14685 UTSW X 73127971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTCCAAAGGTTCCAAAAGAGCAG -3'
(R):5'- TCTCTAGGCCAGCACACTGAACTC -3'

Sequencing Primer
(F):5'- TTCCAAAAGAGCAGGCCAG -3'
(R):5'- AGCACACTGAACTCGTTTTTTG -3'
Posted On2014-03-14