Incidental Mutation 'R1423:Lmbrd1'
ID161154
Institutional Source Beutler Lab
Gene Symbol Lmbrd1
Ensembl Gene ENSMUSG00000073725
Gene NameLMBR1 domain containing 1
Synonyms0910001K20Rik
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location24678630-24766301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24746878 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 418 (V418D)
Ref Sequence ENSEMBL: ENSMUSP00000140783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095062] [ENSMUST00000191471]
Predicted Effect probably damaging
Transcript: ENSMUST00000095062
AA Change: V348D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092672
Gene: ENSMUSG00000073725
AA Change: V348D

DomainStartEndE-ValueType
Pfam:LMBR1 17 292 3e-24 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187468
Predicted Effect unknown
Transcript: ENSMUST00000190195
AA Change: V57D
Predicted Effect probably damaging
Transcript: ENSMUST00000191471
AA Change: V418D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140783
Gene: ENSMUSG00000073725
AA Change: V418D

DomainStartEndE-ValueType
Pfam:LMBR1 12 289 2.7e-19 PFAM
transmembrane domain 303 325 N/A INTRINSIC
low complexity region 344 356 N/A INTRINSIC
transmembrane domain 365 387 N/A INTRINSIC
transmembrane domain 407 429 N/A INTRINSIC
transmembrane domain 486 508 N/A INTRINSIC
low complexity region 522 531 N/A INTRINSIC
Meta Mutation Damage Score 0.3292 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal membrane protein that may be involved in the transport and metabolism of cobalamin. This protein also interacts with the large form of the hepatitis delta antigen and may be required for the nucleocytoplasmic shuttling of the hepatitis delta virus. Mutations in this gene are associated with the vitamin B12 metabolism disorder termed, homocystinuria-megaloblastic anemia complementation type F.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice heterozygous for a targeted allele exhibit increased cardiac cell glucose uptake. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Lmbrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Lmbrd1 APN 1 24705974 splice site probably benign
IGL01897:Lmbrd1 APN 1 24743896 missense possibly damaging 0.47
IGL01950:Lmbrd1 APN 1 24711602 critical splice donor site probably null
IGL02342:Lmbrd1 APN 1 24704878 missense probably damaging 1.00
IGL02888:Lmbrd1 APN 1 24714972 missense possibly damaging 0.94
P0033:Lmbrd1 UTSW 1 24685565 missense possibly damaging 0.95
R0479:Lmbrd1 UTSW 1 24746797 splice site probably benign
R0549:Lmbrd1 UTSW 1 24744920 missense probably benign 0.17
R1015:Lmbrd1 UTSW 1 24731878 nonsense probably null
R1636:Lmbrd1 UTSW 1 24746930 nonsense probably null
R1650:Lmbrd1 UTSW 1 24711558 missense probably damaging 0.97
R1815:Lmbrd1 UTSW 1 24685561 missense possibly damaging 0.55
R2354:Lmbrd1 UTSW 1 24685541 missense probably damaging 1.00
R3690:Lmbrd1 UTSW 1 24762293 makesense probably null
R3713:Lmbrd1 UTSW 1 24692995 missense probably damaging 1.00
R4241:Lmbrd1 UTSW 1 24692968 nonsense probably null
R4627:Lmbrd1 UTSW 1 24705999 missense probably damaging 1.00
R4782:Lmbrd1 UTSW 1 24744975 splice site probably null
R4799:Lmbrd1 UTSW 1 24744975 splice site probably null
R5341:Lmbrd1 UTSW 1 24746811 nonsense probably null
R5430:Lmbrd1 UTSW 1 24692980 missense possibly damaging 0.95
R5483:Lmbrd1 UTSW 1 24744908 missense probably damaging 1.00
R5633:Lmbrd1 UTSW 1 24748862 missense possibly damaging 0.90
R6188:Lmbrd1 UTSW 1 24711545 missense probably benign
R6383:Lmbrd1 UTSW 1 24706034 missense probably damaging 0.99
R6617:Lmbrd1 UTSW 1 24685428 missense probably damaging 1.00
R7060:Lmbrd1 UTSW 1 24692966 missense probably benign 0.00
R7365:Lmbrd1 UTSW 1 24744867 missense possibly damaging 0.62
R7621:Lmbrd1 UTSW 1 24728544 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGAACTGTAGGAGTTTGTCCACAGAAG -3'
(R):5'- GTTCCTCTCACCAAGTTACAGCAGG -3'

Sequencing Primer
(F):5'- TTTGTCCACAGAAGGACTGG -3'
(R):5'- GAACACTTAGCTTAGTGTCATAGG -3'
Posted On2014-03-14