Mutagenetix > Incidental Mutations

Incidental Mutation 'R1423:Mertk'

161158

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

039479-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.121) question?

Stock #

R1423 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128778963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 575 (V575A)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: V575A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: V575A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157160

Meta Mutation Damage Score

0.1623

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.0%
20x: 88.8%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,751,439	E691G	probably damaging	Het
Ankrd13d	A	G	19: 4,281,069	S64P	probably damaging	Het
Bag4	T	C	8: 25,768,274	S342G	probably damaging	Het
Bbs1	G	A	19: 4,894,263	T446I	probably benign	Het
Bmyc	A	G	2: 25,707,224	D100G	probably damaging	Het
Btbd7	T	C	12: 102,785,475	D1010G	possibly damaging	Het
Celsr3	A	T	9: 108,826,905	T196S	probably benign	Het
Crtam	C	A	9: 40,973,622	R161L	probably benign	Het
Cyp11b2	C	A	15: 74,853,130	G290V	probably damaging	Het
Edc4	C	T	8: 105,891,211		probably benign	Het
Exd1	A	T	2: 119,540,013		probably benign	Het
Fam120a	G	T	13: 48,885,743	A979E	possibly damaging	Het
Fbxo16	T	C	14: 65,287,174		probably benign	Het
Fbxo44	C	G	4: 148,156,269	R220S	probably damaging	Het
Gabrb2	A	G	11: 42,529,471	N173S	probably damaging	Het
Gm13741	A	T	2: 87,656,330	I197K	possibly damaging	Het
Helb	T	A	10: 120,108,966	I222F	probably damaging	Het
Hesx1	A	T	14: 27,001,919	Q153L	probably null	Het
Isca1	T	C	13: 59,762,779	N33S	probably benign	Het
Itsn2	T	C	12: 4,673,572	V1142A	probably damaging	Het
Lama5	T	G	2: 180,195,641	T984P	probably damaging	Het
Lima1	T	A	15: 99,819,745	K127*	probably null	Het
Lmbrd1	T	A	1: 24,746,878	V418D	probably damaging	Het
Mkl2	T	C	16: 13,412,241	V930A	possibly damaging	Het
Mrps28	T	C	3: 8,900,124	H85R	probably benign	Het
Naip2	TCCC	TCC	13: 100,154,847		probably benign	Het
Naip2	G	A	13: 100,154,872	S1186F	possibly damaging	Het
Naip2	G	A	13: 100,154,878	T1184M	probably benign	Het
Naip2	C	T	13: 100,161,860	G556D	probably benign	Het
Nhlrc3	A	T	3: 53,462,415	L45H	probably damaging	Het
Olfr285	T	C	15: 98,313,443	T36A	probably damaging	Het
Olfr654	C	T	7: 104,588,475	R224*	probably null	Het
Olfr678	T	G	7: 105,070,019	M184R	probably damaging	Het
Parp14	G	A	16: 35,856,760	A946V	probably benign	Het
Pcdhb15	A	T	18: 37,473,922	D69V	probably damaging	Het
Pitpnm1	G	A	19: 4,112,392	R1074H	probably damaging	Het
Plb1	A	G	5: 32,293,257	N381D	probably benign	Het
Poc1b	T	C	10: 99,152,863	S247P	probably damaging	Het
Prl7b1	T	A	13: 27,602,127	N186I	probably damaging	Het
Riok1	T	C	13: 38,049,114	M241T	probably damaging	Het
Tigit	T	C	16: 43,649,032	E232G	probably benign	Het
Tpst2	T	A	5: 112,307,622	L9Q	probably benign	Het
Ttbk1	T	C	17: 46,446,154		probably benign	Het
Vmn1r3	A	T	4: 3,185,231	N25K	probably damaging	Het
Vmn2r121	T	A	X: 124,129,905	H522L	possibly damaging	Het
Vmn2r15	T	C	5: 109,293,227	Y255C	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCAGACTTCTTCTGCGTGAATCC -3'
(R):5'- TGAAGCTTACTCTGTTCCAGGGACTG -3'

Sequencing Primer
(F):5'- GACGGTCTTACCTTGAAGGATTAATG -3'
(R):5'- AAGCTCCAAAGAAAGAATTATTTGC -3'

Posted On

2014-03-14