Incidental Mutation 'R1423:Fbxo44'
ID161163
Institutional Source Beutler Lab
Gene Symbol Fbxo44
Ensembl Gene ENSMUSG00000029001
Gene NameF-box protein 44
SynonymsFBG3, Fbx6a, FBX30, Fbxo6a
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1423 (G1)
Quality Score163
Status Validated
Chromosome4
Chromosomal Location148152800-148160482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 148156269 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 220 (R220S)
Ref Sequence ENSEMBL: ENSMUSP00000134624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000047951] [ENSMUST00000056965] [ENSMUST00000057907] [ENSMUST00000105705] [ENSMUST00000105706] [ENSMUST00000122913] [ENSMUST00000129253] [ENSMUST00000132083] [ENSMUST00000134261] [ENSMUST00000151127] [ENSMUST00000151246] [ENSMUST00000173352] [ENSMUST00000167160] [ENSMUST00000168503] [ENSMUST00000152098] [ENSMUST00000172472]
Predicted Effect probably benign
Transcript: ENSMUST00000030858
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047951
SMART Domains Protein: ENSMUSP00000037377
Gene: ENSMUSG00000041556

DomainStartEndE-ValueType
Pfam:F-box 50 97 3.8e-9 PFAM
Pfam:F-box-like 51 97 9.3e-8 PFAM
FBA 114 297 3.81e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000056965
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057907
AA Change: R167S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054022
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105705
AA Change: A126P

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101330
Gene: ENSMUSG00000029001
AA Change: A126P

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 196 2.79e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105706
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122913
SMART Domains Protein: ENSMUSP00000120874
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 115 3e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129253
AA Change: R167S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117013
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 213 1.15e-57 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132083
SMART Domains Protein: ENSMUSP00000120431
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134261
SMART Domains Protein: ENSMUSP00000123132
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 228 1.89e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151127
AA Change: R167S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134064
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 235 4.09e-63 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151246
AA Change: R167S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114571
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 231 1.43e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173352
AA Change: R220S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134624
Gene: ENSMUSG00000029001
AA Change: R220S

DomainStartEndE-ValueType
FBOX 62 103 1.37e-2 SMART
FBA 121 254 3.86e-50 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167160
AA Change: R167S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126551
Gene: ENSMUSG00000029001
AA Change: R167S

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
FBA 68 252 2.24e-110 SMART
Predicted Effect unknown
Transcript: ENSMUST00000153703
AA Change: R99S
SMART Domains Protein: ENSMUSP00000115937
Gene: ENSMUSG00000029001
AA Change: R99S

DomainStartEndE-ValueType
FBA 1 143 3.11e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168503
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152098
SMART Domains Protein: ENSMUSP00000121379
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172472
SMART Domains Protein: ENSMUSP00000133966
Gene: ENSMUSG00000029001

DomainStartEndE-ValueType
FBOX 9 50 1.37e-2 SMART
Pfam:FBA 68 126 3.4e-18 PFAM
Meta Mutation Damage Score 0.6806 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It is also a member of the NFB42 (neural F Box 42 kDa) family, similar to F-box only protein 2 and F-box only protein 6. Several alternatively spliced transcript variants encoding two distinct isoforms have been found for this gene. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Fbxo44
AlleleSourceChrCoordTypePredicted EffectPPH Score
trompo UTSW 4 148156004 missense probably benign
R0040:Fbxo44 UTSW 4 148158695 missense probably damaging 1.00
R0737:Fbxo44 UTSW 4 148158809 utr 5 prime probably benign
R0850:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R0899:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1169:Fbxo44 UTSW 4 148155976 missense probably benign 0.01
R1889:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R1895:Fbxo44 UTSW 4 148156269 missense probably damaging 1.00
R3712:Fbxo44 UTSW 4 148156004 missense probably benign
R3774:Fbxo44 UTSW 4 148156594 missense probably damaging 1.00
R3834:Fbxo44 UTSW 4 148156250 missense probably damaging 1.00
R4411:Fbxo44 UTSW 4 148153608 missense probably damaging 1.00
R4810:Fbxo44 UTSW 4 148156446 missense probably damaging 1.00
R5086:Fbxo44 UTSW 4 148156212 missense probably benign 0.00
R5108:Fbxo44 UTSW 4 148158563 missense probably damaging 1.00
R5344:Fbxo44 UTSW 4 148153573 missense probably damaging 0.98
R5423:Fbxo44 UTSW 4 148154229 missense probably benign 0.00
R5930:Fbxo44 UTSW 4 148156595 missense probably damaging 1.00
R6017:Fbxo44 UTSW 4 148158553 missense probably benign 0.17
R6132:Fbxo44 UTSW 4 148156108 missense probably benign 0.10
R6498:Fbxo44 UTSW 4 148154425
R7085:Fbxo44 UTSW 4 148158743 missense probably damaging 0.98
R7142:Fbxo44 UTSW 4 148158812 missense unknown
R7374:Fbxo44 UTSW 4 148156637 missense probably benign 0.21
R7679:Fbxo44 UTSW 4 148153632 missense probably benign 0.43
R8306:Fbxo44 UTSW 4 148158632 missense probably benign 0.42
X0017:Fbxo44 UTSW 4 148156223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGACTCTGTTGTCTAAGCTGGAAG -3'
(R):5'- TGGACCTCAAGGCTGAAGGGTATTG -3'

Sequencing Primer
(F):5'- TGTCTAAGCTGGAAGCTTACTC -3'
(R):5'- GCCCCCTATCTCCCAGG -3'
Posted On2014-03-14