Incidental Mutation 'R1423:Vmn2r15'
ID161165
Institutional Source Beutler Lab
Gene Symbol Vmn2r15
Ensembl Gene ENSMUSG00000091375
Gene Namevomeronasal 2, receptor 15
SynonymsEG211223
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109286269-109297556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109293227 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 255 (Y255C)
Ref Sequence ENSEMBL: ENSMUSP00000128333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167133]
Predicted Effect probably damaging
Transcript: ENSMUST00000167133
AA Change: Y255C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375
AA Change: Y255C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 472 1e-29 PFAM
Pfam:NCD3G 514 568 5.8e-18 PFAM
Pfam:7tm_3 601 836 9.1e-55 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Other mutations in Vmn2r15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r15 APN 5 109286736 missense possibly damaging 0.70
IGL01367:Vmn2r15 APN 5 109293209 missense probably damaging 0.99
IGL01844:Vmn2r15 APN 5 109286269 makesense probably null
IGL02190:Vmn2r15 APN 5 109293374 missense probably damaging 1.00
IGL02754:Vmn2r15 APN 5 109293268 nonsense probably null
IGL02797:Vmn2r15 APN 5 109297384 missense probably benign 0.18
IGL03301:Vmn2r15 APN 5 109297355 critical splice donor site probably null
IGL03407:Vmn2r15 APN 5 109286319 nonsense probably null
BB001:Vmn2r15 UTSW 5 109286388 missense probably damaging 1.00
BB011:Vmn2r15 UTSW 5 109286388 missense probably damaging 1.00
PIT4445001:Vmn2r15 UTSW 5 109287142 missense probably damaging 0.99
PIT4520001:Vmn2r15 UTSW 5 109287005 missense probably damaging 1.00
R0038:Vmn2r15 UTSW 5 109293144 missense possibly damaging 0.46
R0111:Vmn2r15 UTSW 5 109287156 missense possibly damaging 0.56
R0379:Vmn2r15 UTSW 5 109286478 missense probably damaging 1.00
R0427:Vmn2r15 UTSW 5 109287087 missense probably damaging 1.00
R0639:Vmn2r15 UTSW 5 109293015 missense probably benign 0.22
R0964:Vmn2r15 UTSW 5 109297535 missense probably benign 0.34
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1232:Vmn2r15 UTSW 5 109293302 missense probably benign 0.39
R1241:Vmn2r15 UTSW 5 109292904 missense probably damaging 1.00
R1244:Vmn2r15 UTSW 5 109293226 nonsense probably null
R1394:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1395:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1439:Vmn2r15 UTSW 5 109294087 missense probably damaging 1.00
R1513:Vmn2r15 UTSW 5 109293329 missense probably damaging 1.00
R1777:Vmn2r15 UTSW 5 109294270 missense possibly damaging 0.79
R1844:Vmn2r15 UTSW 5 109286994 nonsense probably null
R2072:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2074:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2122:Vmn2r15 UTSW 5 109286456 missense probably damaging 1.00
R2208:Vmn2r15 UTSW 5 109297443 missense possibly damaging 0.64
R2268:Vmn2r15 UTSW 5 109293207 missense probably benign 0.31
R2831:Vmn2r15 UTSW 5 109286592 missense probably damaging 1.00
R3848:Vmn2r15 UTSW 5 109297446 missense probably benign 0.00
R4058:Vmn2r15 UTSW 5 109293446 missense probably damaging 0.99
R4615:Vmn2r15 UTSW 5 109293482 missense possibly damaging 0.91
R4663:Vmn2r15 UTSW 5 109294074 missense probably benign
R4681:Vmn2r15 UTSW 5 109286622 missense probably damaging 0.97
R4751:Vmn2r15 UTSW 5 109286754 missense probably benign 0.01
R5095:Vmn2r15 UTSW 5 109288451 critical splice acceptor site probably null
R5300:Vmn2r15 UTSW 5 109294108 missense probably damaging 0.99
R5309:Vmn2r15 UTSW 5 109293090 missense probably damaging 0.99
R5335:Vmn2r15 UTSW 5 109286807 missense probably damaging 0.99
R5421:Vmn2r15 UTSW 5 109286535 missense probably damaging 1.00
R5805:Vmn2r15 UTSW 5 109286940 missense possibly damaging 0.88
R6280:Vmn2r15 UTSW 5 109293425 missense possibly damaging 0.65
R6324:Vmn2r15 UTSW 5 109286271 makesense probably null
R6383:Vmn2r15 UTSW 5 109293226 nonsense probably null
R6772:Vmn2r15 UTSW 5 109286372 missense probably damaging 0.99
R6991:Vmn2r15 UTSW 5 109293314 missense probably damaging 1.00
R7194:Vmn2r15 UTSW 5 109292783 missense probably damaging 1.00
R7365:Vmn2r15 UTSW 5 109293239 missense probably benign 0.19
R7365:Vmn2r15 UTSW 5 109297522 missense probably benign 0.15
R7423:Vmn2r15 UTSW 5 109297528 missense probably benign 0.00
R7552:Vmn2r15 UTSW 5 109292908 nonsense probably null
R7619:Vmn2r15 UTSW 5 109288324 critical splice donor site probably null
R7892:Vmn2r15 UTSW 5 109286351 missense probably damaging 1.00
R7924:Vmn2r15 UTSW 5 109286388 missense probably damaging 1.00
R8058:Vmn2r15 UTSW 5 109293090 missense probably damaging 0.99
R8099:Vmn2r15 UTSW 5 109293319 missense possibly damaging 0.58
R8189:Vmn2r15 UTSW 5 109286847 missense probably benign 0.02
R8275:Vmn2r15 UTSW 5 109286284 missense probably benign 0.08
R8277:Vmn2r15 UTSW 5 109293104 missense probably benign 0.00
R8277:Vmn2r15 UTSW 5 109293444 missense probably damaging 1.00
X0065:Vmn2r15 UTSW 5 109293308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTGCAAAAGTGACAGTTCCG -3'
(R):5'- CCTGAGTGACCATGACCAGTTTCC -3'

Sequencing Primer
(F):5'- TGACAGTTCCGTGAAAGAAATC -3'
(R):5'- TATGTCCATCAGGTAGCCATCAAG -3'
Posted On2014-03-14