Incidental Mutation 'R1423:Olfr654'
ID161167
Institutional Source Beutler Lab
Gene Symbol Olfr654
Ensembl Gene ENSMUSG00000073925
Gene Nameolfactory receptor 654
SynonymsGA_x6K02T2PBJ9-7215221-7216195, MOR38-2
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104587025-104590718 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 104588475 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 224 (R224*)
Ref Sequence ENSEMBL: ENSMUSP00000149640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098173] [ENSMUST00000210457] [ENSMUST00000213984] [ENSMUST00000215585] [ENSMUST00000217466]
Predicted Effect probably null
Transcript: ENSMUST00000098173
AA Change: R241*
SMART Domains Protein: ENSMUSP00000095775
Gene: ENSMUSG00000073925
AA Change: R241*

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Pfam:7TM_GPCR_Srbc 43 176 2.5e-8 PFAM
Pfam:7tm_4 49 328 1.7e-103 PFAM
Pfam:7TM_GPCR_Srsx 53 325 1.6e-7 PFAM
Pfam:7tm_1 59 310 9.2e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000210457
AA Change: R224*
Predicted Effect probably null
Transcript: ENSMUST00000213984
AA Change: R224*
Predicted Effect probably benign
Transcript: ENSMUST00000215585
Predicted Effect probably benign
Transcript: ENSMUST00000217466
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Olfr654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr654 APN 7 104587860 missense probably damaging 1.00
IGL01677:Olfr654 APN 7 104588145 missense probably damaging 0.97
IGL01807:Olfr654 APN 7 104587884 missense probably damaging 1.00
IGL03113:Olfr654 APN 7 104588733 missense probably benign 0.01
R0504:Olfr654 UTSW 7 104588475 nonsense probably null
R0647:Olfr654 UTSW 7 104588115 missense probably damaging 1.00
R0941:Olfr654 UTSW 7 104588338 missense probably damaging 1.00
R0945:Olfr654 UTSW 7 104588672 missense probably damaging 1.00
R1860:Olfr654 UTSW 7 104587905 missense probably damaging 0.98
R2872:Olfr654 UTSW 7 104588493 missense possibly damaging 0.87
R2872:Olfr654 UTSW 7 104588493 missense possibly damaging 0.87
R4082:Olfr654 UTSW 7 104588623 missense probably damaging 1.00
R4760:Olfr654 UTSW 7 104588489 missense probably benign 0.32
R4787:Olfr654 UTSW 7 104587960 missense probably benign
R4969:Olfr654 UTSW 7 104588523 missense probably damaging 1.00
R5186:Olfr654 UTSW 7 104588211 missense probably damaging 1.00
R5706:Olfr654 UTSW 7 104587890 missense probably benign 0.02
R6582:Olfr654 UTSW 7 104588011 missense probably damaging 1.00
R7076:Olfr654 UTSW 7 104588223 missense probably damaging 1.00
R7155:Olfr654 UTSW 7 104588557 missense possibly damaging 0.88
R7424:Olfr654 UTSW 7 104588700 missense probably damaging 1.00
R7559:Olfr654 UTSW 7 104587880 missense probably damaging 1.00
R7722:Olfr654 UTSW 7 104588298 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAGCTATGAAGGCTGCTTGGTCC -3'
(R):5'- ATGAGGTGGAATGCCTCTCCCAAAG -3'

Sequencing Primer
(F):5'- ATTGGACTCATTGGCCTAGCAAG -3'
(R):5'- TCTCCCAAAGCGATGAGTCAG -3'
Posted On2014-03-14