Incidental Mutation 'R1423:Crtam'
ID161171
Institutional Source Beutler Lab
Gene Symbol Crtam
Ensembl Gene ENSMUSG00000032021
Gene Namecytotoxic and regulatory T cell molecule
Synonymsclass I-restricted T cell-associated molecule
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1423 (G1)
Quality Score190
Status Validated
Chromosome9
Chromosomal Location40969691-41004628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 40973622 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 161 (R161L)
Ref Sequence ENSEMBL: ENSMUSP00000137749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034519] [ENSMUST00000180384] [ENSMUST00000180872] [ENSMUST00000188848]
Predicted Effect probably benign
Transcript: ENSMUST00000034519
AA Change: R351L

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034519
Gene: ENSMUSG00000032021
AA Change: R351L

DomainStartEndE-ValueType
IG 21 113 4.7e-9 SMART
Pfam:C2-set_2 119 205 2.7e-16 PFAM
low complexity region 222 239 N/A INTRINSIC
transmembrane domain 283 305 N/A INTRINSIC
low complexity region 326 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180384
AA Change: R358L

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137837
Gene: ENSMUSG00000032021
AA Change: R358L

DomainStartEndE-ValueType
IG 21 113 4.7e-9 SMART
Pfam:C2-set_2 119 205 4.2e-15 PFAM
low complexity region 229 246 N/A INTRINSIC
transmembrane domain 290 312 N/A INTRINSIC
low complexity region 333 352 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180872
AA Change: R161L

PolyPhen 2 Score 0.361 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137749
Gene: ENSMUSG00000032021
AA Change: R161L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
low complexity region 136 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188848
AA Change: R357L

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139826
Gene: ENSMUSG00000032021
AA Change: R357L

DomainStartEndE-ValueType
IG 21 113 4.7e-9 SMART
Pfam:C2-set_2 119 205 1.9e-15 PFAM
low complexity region 229 246 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
low complexity region 332 351 N/A INTRINSIC
Meta Mutation Damage Score 0.1062 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CRTAM gene is upregulated in CD4 (see MIM 186940)-positive and CD8 (see CD8A; MIM 186910)-positive T cells and encodes a type I transmembrane protein with V and C1-like Ig domains (Yeh et al., 2008 [PubMed 18329370]).[supplied by OMIM, Feb 2009]
PHENOTYPE: Homozygous null mice have defects in late stage T cell activation that leads to less production of inflammatory cytokines, higher proliferation, and an increase in T cell number with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Crtam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02883:Crtam APN 9 40994501 missense probably benign
R0722:Crtam UTSW 9 40992616 missense probably damaging 1.00
R1859:Crtam UTSW 9 40973604 missense possibly damaging 0.71
R1935:Crtam UTSW 9 41004550 missense probably benign 0.34
R1936:Crtam UTSW 9 41004550 missense probably benign 0.34
R2090:Crtam UTSW 9 40984316 missense possibly damaging 0.77
R2360:Crtam UTSW 9 40973515 makesense probably null
R4812:Crtam UTSW 9 40984325 missense probably damaging 0.99
R5995:Crtam UTSW 9 40994540 missense possibly damaging 0.75
R6021:Crtam UTSW 9 40990181 missense probably damaging 1.00
R7428:Crtam UTSW 9 40981182 missense probably benign 0.24
RF044:Crtam UTSW 9 40984354 frame shift probably null
RF057:Crtam UTSW 9 40984354 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCTGGCTCAATGGACACTGTCTTG -3'
(R):5'- ATTGCCTCAGTGCCTCAAACCC -3'

Sequencing Primer
(F):5'- GGACACTGTCTTGAATTGTACTC -3'
(R):5'- CAAATACACGGGTGCAACAC -3'
Posted On2014-03-14