Incidental Mutation 'R1423:Riok1'
ID161179
Institutional Source Beutler Lab
Gene Symbol Riok1
Ensembl Gene ENSMUSG00000021428
Gene NameRIO kinase 1
Synonyms
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location38036995-38061433 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38049114 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 241 (M241T)
Ref Sequence ENSEMBL: ENSMUSP00000021866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021866] [ENSMUST00000223656] [ENSMUST00000224477]
Predicted Effect probably damaging
Transcript: ENSMUST00000021866
AA Change: M241T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021866
Gene: ENSMUSG00000021428
AA Change: M241T

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
RIO 150 386 5.1e-134 SMART
Blast:RIO 465 531 4e-12 BLAST
low complexity region 551 567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223910
Predicted Effect probably benign
Transcript: ENSMUST00000224477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224683
Predicted Effect unknown
Transcript: ENSMUST00000224956
AA Change: M185T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226006
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226056
Meta Mutation Damage Score 0.9311 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a member of the RIO family of atypical serine protein kinases. A similar protein in humans is a component of the protein arginine methyltransferase 5 complex that specifically recruits the RNA-binding protein nucleolin as a methylation substrate. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Riok1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Riok1 APN 13 38059956 missense possibly damaging 0.80
IGL02675:Riok1 APN 13 38050243 missense probably damaging 0.99
IGL02892:Riok1 APN 13 38040065 splice site probably benign
IGL02952:Riok1 APN 13 38048890 missense probably damaging 1.00
IGL03386:Riok1 APN 13 38057237 nonsense probably null
IGL03054:Riok1 UTSW 13 38047315 missense probably damaging 1.00
R0959:Riok1 UTSW 13 38057173 missense probably damaging 0.96
R1558:Riok1 UTSW 13 38050855 missense probably damaging 1.00
R1624:Riok1 UTSW 13 38037511 missense probably damaging 1.00
R1717:Riok1 UTSW 13 38052950 missense probably damaging 1.00
R1858:Riok1 UTSW 13 38058718 nonsense probably null
R1920:Riok1 UTSW 13 38057201 missense probably benign 0.27
R2857:Riok1 UTSW 13 38049077 missense probably damaging 1.00
R4179:Riok1 UTSW 13 38048955 missense probably damaging 1.00
R7052:Riok1 UTSW 13 38037015 unclassified probably benign
R7354:Riok1 UTSW 13 38047312 missense probably benign 0.15
R7689:Riok1 UTSW 13 38045287 missense probably damaging 1.00
R8207:Riok1 UTSW 13 38052320 missense probably damaging 1.00
R8432:Riok1 UTSW 13 38037492 missense probably benign 0.01
Z1176:Riok1 UTSW 13 38058723 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTTCAGAGAAGCGAGTCATTAAGCAG -3'
(R):5'- CTACATAGTCTAAAGGGTCCCCTCGG -3'

Sequencing Primer
(F):5'- CCCCTTATTGAGCAGAGTGTCATAG -3'
(R):5'- TCCCCTCGGCTTGGAAAG -3'
Posted On2014-03-14