Incidental Mutation 'R1423:Isca1'
ID161180
Institutional Source Beutler Lab
Gene Symbol Isca1
Ensembl Gene ENSMUSG00000044792
Gene Nameiron-sulfur cluster assembly 1
SynonymsHbld2, 1810010A06Rik
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location59755409-59769810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59762779 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 33 (N33S)
Ref Sequence ENSEMBL: ENSMUSP00000153175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057115] [ENSMUST00000225850]
Predicted Effect probably benign
Transcript: ENSMUST00000057115
AA Change: N33S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000054858
Gene: ENSMUSG00000044792
AA Change: N33S

DomainStartEndE-ValueType
Pfam:Fe-S_biosyn 23 125 7.4e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160628
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225284
Predicted Effect silent
Transcript: ENSMUST00000225581
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225795
Predicted Effect probably benign
Transcript: ENSMUST00000225850
AA Change: N33S

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225877
Meta Mutation Damage Score 0.0580 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ISCA1 is a mitochondrial protein involved in the biogenesis and assembly of iron-sulfur clusters, which play a role in electron-transfer reactions (Cozar-Castellano et al., 2004 [PubMed 15262227]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Isca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Isca1 APN 13 59758971 missense probably benign 0.01
IGL02493:Isca1 APN 13 59762782 missense possibly damaging 0.89
ANU05:Isca1 UTSW 13 59758971 missense probably benign 0.01
R0394:Isca1 UTSW 13 59758885 splice site probably null
R0557:Isca1 UTSW 13 59756974 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGTGAGCACGTAGACAAGCTCAG -3'
(R):5'- ACAAAATATAACCTCAGGGGCGTGG -3'

Sequencing Primer
(F):5'- CATGAGCAGCCTGTGTAAGATTC -3'
(R):5'- TCCTCTGGAAAGACATGGCT -3'
Posted On2014-03-14