Incidental Mutation 'R1423:Fbxo16'
Institutional Source Beutler Lab
Gene Symbol Fbxo16
Ensembl Gene ENSMUSG00000034532
Gene NameF-box protein 16
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosomal Location65266618-65323973 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 65287174 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169656] [ENSMUST00000224629] [ENSMUST00000226005]
Predicted Effect probably benign
Transcript: ENSMUST00000169656
SMART Domains Protein: ENSMUSP00000130805
Gene: ENSMUSG00000034532

FBOX 92 132 3.43e-3 SMART
low complexity region 194 206 N/A INTRINSIC
low complexity region 323 334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223608
Predicted Effect probably benign
Transcript: ENSMUST00000224629
Predicted Effect probably benign
Transcript: ENSMUST00000226005
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Fbxo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Fbxo16 APN 14 65321287 missense probably benign 0.15
R1129:Fbxo16 UTSW 14 65295532 missense probably benign
R1776:Fbxo16 UTSW 14 65295386 splice site probably null
R1862:Fbxo16 UTSW 14 65270803 missense probably damaging 1.00
R2504:Fbxo16 UTSW 14 65270714 start gained probably benign
R3431:Fbxo16 UTSW 14 65293784 missense probably damaging 0.97
R3432:Fbxo16 UTSW 14 65293784 missense probably damaging 0.97
R3976:Fbxo16 UTSW 14 65287157 missense probably damaging 1.00
R4065:Fbxo16 UTSW 14 65270829 missense probably damaging 1.00
R4922:Fbxo16 UTSW 14 65299208 missense probably benign
R4973:Fbxo16 UTSW 14 65321297 missense probably benign 0.00
R6637:Fbxo16 UTSW 14 65295761 splice site probably null
R7213:Fbxo16 UTSW 14 65299419 splice site probably null
R7274:Fbxo16 UTSW 14 65321267 missense probably benign 0.30
Z1088:Fbxo16 UTSW 14 65293860 missense possibly damaging 0.92
Z1177:Fbxo16 UTSW 14 65299358 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- ggaagtagagacaggaagatagg -3'
(R):5'- TTTTTATTATCAcctccctccctctc -3'
Posted On2014-03-14