Incidental Mutation 'R1423:Cyp11b2'
ID161187
Institutional Source Beutler Lab
Gene Symbol Cyp11b2
Ensembl Gene ENSMUSG00000022589
Gene Namecytochrome P450, family 11, subfamily b, polypeptide 2
SynonymsCyp11b-2, Cyp11b, aldosterone synthase, steroid-11-beta-hydroxylase
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location74851010-74856318 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74853130 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 290 (G290V)
Ref Sequence ENSEMBL: ENSMUSP00000131503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167634]
Predicted Effect probably damaging
Transcript: ENSMUST00000167634
AA Change: G290V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131503
Gene: ENSMUSG00000022589
AA Change: G290V

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
Pfam:p450 44 498 1e-115 PFAM
Meta Mutation Damage Score 0.9076 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the mitochondrial inner membrane and is involved in the conversion of progesterone to cortisol in the adrenal cortex. Mutations in this gene cause congenital adrenal hyperplasia due to 11-beta-hydroxylase deficiency. Transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some postnatal lethality, altered blood chemistry, hypotension, and abnormal adrenal cortex morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Cyp11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Cyp11b2 APN 15 74853515 missense probably benign 0.00
IGL02058:Cyp11b2 APN 15 74853189 missense probably benign 0.30
IGL02419:Cyp11b2 APN 15 74851055 missense probably damaging 1.00
IGL03094:Cyp11b2 APN 15 74853037 critical splice donor site probably null
IGL03237:Cyp11b2 APN 15 74851065 missense probably benign 0.00
Spargel UTSW 15 74851432 missense probably damaging 1.00
stickfigure UTSW 15 74851570 missense possibly damaging 0.46
Stringbean UTSW 15 74853130 missense probably damaging 1.00
veronica UTSW 15 74853991 missense probably damaging 1.00
PIT4243001:Cyp11b2 UTSW 15 74851453 missense probably damaging 1.00
R0522:Cyp11b2 UTSW 15 74851684 splice site probably benign
R0674:Cyp11b2 UTSW 15 74855544 missense probably damaging 1.00
R0837:Cyp11b2 UTSW 15 74853641 missense probably damaging 1.00
R1386:Cyp11b2 UTSW 15 74851775 critical splice acceptor site probably null
R1550:Cyp11b2 UTSW 15 74853593 missense probably benign 0.07
R3437:Cyp11b2 UTSW 15 74855449 missense probably benign
R3693:Cyp11b2 UTSW 15 74856008 missense probably benign 0.00
R4447:Cyp11b2 UTSW 15 74855563 missense probably benign 0.00
R4870:Cyp11b2 UTSW 15 74853146 missense probably benign 0.00
R4947:Cyp11b2 UTSW 15 74851570 missense possibly damaging 0.46
R4968:Cyp11b2 UTSW 15 74854005 splice site probably null
R5115:Cyp11b2 UTSW 15 74855428 critical splice donor site probably null
R5775:Cyp11b2 UTSW 15 74853478 missense probably benign 0.02
R6738:Cyp11b2 UTSW 15 74853514 missense possibly damaging 0.65
R6841:Cyp11b2 UTSW 15 74855491 missense probably benign 0.00
R6942:Cyp11b2 UTSW 15 74856245 start gained probably benign
R6997:Cyp11b2 UTSW 15 74851432 missense probably damaging 1.00
R7094:Cyp11b2 UTSW 15 74853658 missense possibly damaging 0.94
R7096:Cyp11b2 UTSW 15 74855988 missense probably damaging 0.98
R7275:Cyp11b2 UTSW 15 74853991 missense probably damaging 1.00
R7456:Cyp11b2 UTSW 15 74853530 missense probably benign 0.01
R7604:Cyp11b2 UTSW 15 74853750 splice site probably null
R8002:Cyp11b2 UTSW 15 74856032 missense probably damaging 1.00
R8222:Cyp11b2 UTSW 15 74856210 missense probably benign 0.03
R8346:Cyp11b2 UTSW 15 74851768 missense probably damaging 1.00
R8349:Cyp11b2 UTSW 15 74851579 missense possibly damaging 0.94
R8449:Cyp11b2 UTSW 15 74851579 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGGCACACCTCTAGGTACAGTCTTC -3'
(R):5'- CTCAAATGATGGCAACCACTGCTTC -3'

Sequencing Primer
(F):5'- CCTCTAGGTACAGTCTTCAATCAAAG -3'
(R):5'- CCTATGACTGAAAGGACCTAGTGAC -3'
Posted On2014-03-14