Incidental Mutation 'R1423:Ttbk1'
ID161193
Institutional Source Beutler Lab
Gene Symbol Ttbk1
Ensembl Gene ENSMUSG00000015599
Gene Nametau tubulin kinase 1
Synonyms
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R1423 (G1)
Quality Score191
Status Validated
Chromosome17
Chromosomal Location46442448-46487675 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 46446154 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034]
Predicted Effect probably benign
Transcript: ENSMUST00000047034
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene belongs to the casein kinase 1 superfamily. The encoded protein is a neuron-specific, serine/threonine and tyrosine kinase, which regulates phosphorylation of tau, a protein that associates with microtubule assemblies and stabilizes them. Genetic variants in this gene are associated with Alzheimer's disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Ttbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Ttbk1 APN 17 46447063 missense probably damaging 1.00
IGL02469:Ttbk1 APN 17 46470630 missense possibly damaging 0.77
IGL02826:Ttbk1 APN 17 46470660 missense probably benign
IGL02874:Ttbk1 APN 17 46470225 missense probably benign 0.10
IGL02948:Ttbk1 APN 17 46446330 missense probably benign 0.44
IGL03037:Ttbk1 APN 17 46446330 missense probably benign 0.44
R0165:Ttbk1 UTSW 17 46478938 missense possibly damaging 0.70
R1186:Ttbk1 UTSW 17 46467131 missense probably damaging 1.00
R1228:Ttbk1 UTSW 17 46476712 critical splice donor site probably null
R1477:Ttbk1 UTSW 17 46476799 missense probably benign 0.05
R1960:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R1961:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R4043:Ttbk1 UTSW 17 46446762 missense probably benign 0.21
R4190:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4192:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4193:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4660:Ttbk1 UTSW 17 46477788 nonsense probably null
R5383:Ttbk1 UTSW 17 46467416 missense probably damaging 1.00
R5385:Ttbk1 UTSW 17 46447632 missense probably benign 0.00
R5715:Ttbk1 UTSW 17 46479207 missense probably damaging 0.99
R6218:Ttbk1 UTSW 17 46470807 missense possibly damaging 0.47
R6263:Ttbk1 UTSW 17 46467262 missense probably damaging 1.00
R6471:Ttbk1 UTSW 17 46467277 missense probably benign
R6537:Ttbk1 UTSW 17 46470310 missense probably damaging 0.98
R6552:Ttbk1 UTSW 17 46478962 missense probably benign 0.14
R7564:Ttbk1 UTSW 17 46476931 missense possibly damaging 0.66
R7853:Ttbk1 UTSW 17 46447343 missense probably benign 0.00
R7871:Ttbk1 UTSW 17 46446238 missense probably benign
R7873:Ttbk1 UTSW 17 46446568 missense probably damaging 1.00
R7908:Ttbk1 UTSW 17 46478938 missense probably damaging 1.00
R8210:Ttbk1 UTSW 17 46480161 missense possibly damaging 0.95
R8236:Ttbk1 UTSW 17 46470729 missense probably damaging 1.00
X0066:Ttbk1 UTSW 17 46446856 missense possibly damaging 0.74
Z1088:Ttbk1 UTSW 17 46446325 missense probably benign 0.35
Z1176:Ttbk1 UTSW 17 46460911 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGACAGAACTGGCACTTGAACCAC -3'
(R):5'- CCCAGAAGCCGTATTCCTGTCTTG -3'

Sequencing Primer
(F):5'- TTGAACCACAAGTGACACAGTG -3'
(R):5'- TGAGACACTCTCAGGCACTG -3'
Posted On2014-03-14