Incidental Mutation 'R1423:Ankrd13d'
ID161196
Institutional Source Beutler Lab
Gene Symbol Ankrd13d
Ensembl Gene ENSMUSG00000005986
Gene Nameankyrin repeat domain 13 family, member D
Synonyms
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1423 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4270180-4283137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4281069 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 64 (S64P)
Ref Sequence ENSEMBL: ENSMUSP00000130995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025791] [ENSMUST00000056888] [ENSMUST00000088737] [ENSMUST00000113837] [ENSMUST00000163858] [ENSMUST00000167215] [ENSMUST00000169192] [ENSMUST00000171123]
Predicted Effect probably benign
Transcript: ENSMUST00000025791
SMART Domains Protein: ENSMUSP00000025791
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 12 133 3.17e-30 SMART
S_TKc 149 411 2.43e-86 SMART
S_TK_X 412 491 5.3e-9 SMART
PH 517 612 2.79e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056888
AA Change: S137P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053783
Gene: ENSMUSG00000005986
AA Change: S137P

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Pfam:GPCR_chapero_1 155 469 1.2e-111 PFAM
UIM 482 501 3.2e-2 SMART
UIM 528 547 1.92e2 SMART
UIM 564 583 8.18e0 SMART
UIM 589 605 6e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088737
SMART Domains Protein: ENSMUSP00000086114
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
S_TKc 191 453 2.43e-86 SMART
S_TK_X 454 533 5.3e-9 SMART
PH 559 654 2.79e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113837
SMART Domains Protein: ENSMUSP00000109468
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163858
SMART Domains Protein: ENSMUSP00000128932
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000167215
SMART Domains Protein: ENSMUSP00000128037
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169192
AA Change: S64P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130995
Gene: ENSMUSG00000005986
AA Change: S64P

DomainStartEndE-ValueType
Blast:ANK 1 28 5e-11 BLAST
Pfam:GPCR_chapero_1 82 121 6.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169653
Predicted Effect probably benign
Transcript: ENSMUST00000170283
SMART Domains Protein: ENSMUSP00000126349
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 98 9.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171123
SMART Domains Protein: ENSMUSP00000126930
Gene: ENSMUSG00000024858

DomainStartEndE-ValueType
RGS 54 175 3.17e-30 SMART
Pfam:Pkinase_Tyr 191 378 1.1e-21 PFAM
Pfam:Pkinase 191 381 4.9e-50 PFAM
Meta Mutation Damage Score 0.5764 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat domain (ANKRD) 13 family, which currently consists of four proteins containing ubiquitin-interacting motifs. These proteins are integral membrane proteins that bind specifically to Lys-63-linked ubiquitin chains on membrane-bound proteins, targeting those proteins for rapid internalization. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bbs1 G A 19: 4,894,263 T446I probably benign Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Ankrd13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Ankrd13d APN 19 4273564 missense probably benign 0.21
IGL02480:Ankrd13d APN 19 4271463 missense possibly damaging 0.67
R0639:Ankrd13d UTSW 19 4273019 critical splice donor site probably null
R0673:Ankrd13d UTSW 19 4273019 critical splice donor site probably null
R1592:Ankrd13d UTSW 19 4282891 missense probably benign 0.21
R1682:Ankrd13d UTSW 19 4282933 missense probably damaging 1.00
R1843:Ankrd13d UTSW 19 4271595 missense probably damaging 0.99
R2277:Ankrd13d UTSW 19 4280984 missense probably benign 0.03
R2376:Ankrd13d UTSW 19 4272595 missense possibly damaging 0.79
R2483:Ankrd13d UTSW 19 4281940 missense probably damaging 0.96
R3623:Ankrd13d UTSW 19 4281940 missense probably damaging 0.96
R4066:Ankrd13d UTSW 19 4270360 missense probably benign 0.00
R5871:Ankrd13d UTSW 19 4281994 missense possibly damaging 0.92
R6011:Ankrd13d UTSW 19 4281934 missense probably damaging 1.00
R6057:Ankrd13d UTSW 19 4282228 missense probably damaging 0.97
R6167:Ankrd13d UTSW 19 4273053 missense probably damaging 1.00
R7747:Ankrd13d UTSW 19 4280985 missense probably damaging 0.98
R7921:Ankrd13d UTSW 19 4271030 missense probably damaging 0.99
R8189:Ankrd13d UTSW 19 4270852 missense probably benign 0.08
R8205:Ankrd13d UTSW 19 4280981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACATGCTTAAAAGCCACCAGG -3'
(R):5'- CCAAAGAGTAGTTGTGAGGCCCAAG -3'

Sequencing Primer
(F):5'- GCCACCAGGGAATCTGAG -3'
(R):5'- GGTTTTTCTTAGGCCCCTGA -3'
Posted On2014-03-14