Incidental Mutation 'R1423:Bbs1'
ID161197
Institutional Source Beutler Lab
Gene Symbol Bbs1
Ensembl Gene ENSMUSG00000006464
Gene NameBardet-Biedl syndrome 1 (human)
SynonymsD19Ertd609e
MMRRC Submission 039479-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R1423 (G1)
Quality Score155
Status Validated
Chromosome19
Chromosomal Location4886898-4906627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4894263 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 446 (T446I)
Ref Sequence ENSEMBL: ENSMUSP00000055321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053506]
Predicted Effect probably benign
Transcript: ENSMUST00000053506
AA Change: T446I

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055321
Gene: ENSMUSG00000006464
AA Change: T446I

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BBS1 23 276 2.7e-104 PFAM
low complexity region 293 305 N/A INTRINSIC
low complexity region 458 466 N/A INTRINSIC
Meta Mutation Damage Score 0.1432 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.0%
  • 20x: 88.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity after weaning, retinal degeneration, and abnormal olfactory epithelium and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,751,439 E691G probably damaging Het
Ankrd13d A G 19: 4,281,069 S64P probably damaging Het
Bag4 T C 8: 25,768,274 S342G probably damaging Het
Bmyc A G 2: 25,707,224 D100G probably damaging Het
Btbd7 T C 12: 102,785,475 D1010G possibly damaging Het
Celsr3 A T 9: 108,826,905 T196S probably benign Het
Crtam C A 9: 40,973,622 R161L probably benign Het
Cyp11b2 C A 15: 74,853,130 G290V probably damaging Het
Edc4 C T 8: 105,891,211 probably benign Het
Exd1 A T 2: 119,540,013 probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbxo16 T C 14: 65,287,174 probably benign Het
Fbxo44 C G 4: 148,156,269 R220S probably damaging Het
Gabrb2 A G 11: 42,529,471 N173S probably damaging Het
Gm13741 A T 2: 87,656,330 I197K possibly damaging Het
Helb T A 10: 120,108,966 I222F probably damaging Het
Hesx1 A T 14: 27,001,919 Q153L probably null Het
Isca1 T C 13: 59,762,779 N33S probably benign Het
Itsn2 T C 12: 4,673,572 V1142A probably damaging Het
Lama5 T G 2: 180,195,641 T984P probably damaging Het
Lima1 T A 15: 99,819,745 K127* probably null Het
Lmbrd1 T A 1: 24,746,878 V418D probably damaging Het
Mertk T C 2: 128,778,963 V575A probably damaging Het
Mkl2 T C 16: 13,412,241 V930A possibly damaging Het
Mrps28 T C 3: 8,900,124 H85R probably benign Het
Naip2 TCCC TCC 13: 100,154,847 probably benign Het
Naip2 G A 13: 100,154,872 S1186F possibly damaging Het
Naip2 G A 13: 100,154,878 T1184M probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nhlrc3 A T 3: 53,462,415 L45H probably damaging Het
Olfr285 T C 15: 98,313,443 T36A probably damaging Het
Olfr654 C T 7: 104,588,475 R224* probably null Het
Olfr678 T G 7: 105,070,019 M184R probably damaging Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdhb15 A T 18: 37,473,922 D69V probably damaging Het
Pitpnm1 G A 19: 4,112,392 R1074H probably damaging Het
Plb1 A G 5: 32,293,257 N381D probably benign Het
Poc1b T C 10: 99,152,863 S247P probably damaging Het
Prl7b1 T A 13: 27,602,127 N186I probably damaging Het
Riok1 T C 13: 38,049,114 M241T probably damaging Het
Tigit T C 16: 43,649,032 E232G probably benign Het
Tpst2 T A 5: 112,307,622 L9Q probably benign Het
Ttbk1 T C 17: 46,446,154 probably benign Het
Vmn1r3 A T 4: 3,185,231 N25K probably damaging Het
Vmn2r121 T A X: 124,129,905 H522L possibly damaging Het
Vmn2r15 T C 5: 109,293,227 Y255C probably damaging Het
Other mutations in Bbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bbs1 APN 19 4893010 missense probably benign
IGL01110:Bbs1 APN 19 4892925 missense possibly damaging 0.93
IGL01116:Bbs1 APN 19 4902839 splice site probably benign
IGL01480:Bbs1 APN 19 4894393 missense probably damaging 1.00
IGL01926:Bbs1 APN 19 4902863 missense probably benign 0.01
IGL02893:Bbs1 APN 19 4897576 nonsense probably null
IGL03136:Bbs1 APN 19 4890991 missense probably benign 0.10
IGL03342:Bbs1 APN 19 4897593 missense probably damaging 1.00
bookface UTSW 19 4897326 missense possibly damaging 0.81
PIT4131001:Bbs1 UTSW 19 4899259 missense possibly damaging 0.83
PIT4378001:Bbs1 UTSW 19 4891675 missense probably benign 0.05
PIT4468001:Bbs1 UTSW 19 4906162 missense probably benign 0.19
R0023:Bbs1 UTSW 19 4906014 missense probably damaging 1.00
R0023:Bbs1 UTSW 19 4906014 missense probably damaging 1.00
R0127:Bbs1 UTSW 19 4895029 missense probably benign 0.05
R1760:Bbs1 UTSW 19 4894322 missense probably benign 0.10
R1992:Bbs1 UTSW 19 4891708 missense probably benign
R2145:Bbs1 UTSW 19 4903707 missense possibly damaging 0.71
R4097:Bbs1 UTSW 19 4897317 missense probably damaging 1.00
R5717:Bbs1 UTSW 19 4897326 missense possibly damaging 0.81
R5947:Bbs1 UTSW 19 4892994 missense probably benign 0.27
R6005:Bbs1 UTSW 19 4903795 nonsense probably null
R6175:Bbs1 UTSW 19 4890721 missense probably damaging 1.00
R6597:Bbs1 UTSW 19 4899306 missense probably benign 0.01
R6734:Bbs1 UTSW 19 4903896 missense probably benign 0.10
R6772:Bbs1 UTSW 19 4906590 unclassified probably benign
R6805:Bbs1 UTSW 19 4900615 missense probably damaging 1.00
R6838:Bbs1 UTSW 19 4903852 missense possibly damaging 0.47
R7198:Bbs1 UTSW 19 4895015 missense probably damaging 0.97
R7276:Bbs1 UTSW 19 4897710 splice site probably null
R7685:Bbs1 UTSW 19 4906154 missense probably benign 0.43
R7696:Bbs1 UTSW 19 4890989 critical splice donor site probably null
R7933:Bbs1 UTSW 19 4891650 splice site probably benign
Y5404:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Y5407:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CTGAAAGTAACTGCCTCTGGTGCTC -3'
(R):5'- TCAGAAGGACCGACATGCTTGGAC -3'

Sequencing Primer
(F):5'- GTGCTCTCGCCAGCATC -3'
(R):5'- CATGCTTGGACAAGAGTGCC -3'
Posted On2014-03-14