Incidental Mutation 'R1424:Kcnj10'
ID161201
Institutional Source Beutler Lab
Gene Symbol Kcnj10
Ensembl Gene ENSMUSG00000044708
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 10
SynonymsBIR10, Kir4.1, Kir1.2, Kir4.1, BIRK-1
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172341210-172374085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172369255 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 112 (V112E)
Ref Sequence ENSEMBL: ENSMUSP00000054356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056136]
Predicted Effect probably damaging
Transcript: ENSMUST00000056136
AA Change: V112E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000054356
Gene: ENSMUSG00000044708
AA Change: V112E

DomainStartEndE-ValueType
Pfam:IRK 31 363 2.2e-136 PFAM
Meta Mutation Damage Score 0.9390 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inward rectifier-type potassium channel family, characterized by having a greater tendency to allow potassium to flow into, rather than out of, a cell. The encoded protein may form a heterodimer with another potassium channel protein and may be responsible for the potassium buffering action of glial cells in the brain. Mutations in this gene have been associated with seizure susceptibility of common idiopathic generalized epilepsy syndromes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice show increased input resistance and high depolarization of retinal Muller cells, loss of the endocochlear potential, motor coordination deficits and hindlimb paralysis, and a hypomyelination and spongiform vacuolation in the spinalcord associated with severe axonal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Kcnj10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Kcnj10 APN 1 172369583 missense probably benign 0.11
IGL02743:Kcnj10 APN 1 172369654 missense possibly damaging 0.95
R0052:Kcnj10 UTSW 1 172368924 missense probably benign 0.30
R0490:Kcnj10 UTSW 1 172369452 missense probably damaging 0.96
R2153:Kcnj10 UTSW 1 172369888 missense possibly damaging 0.90
R3735:Kcnj10 UTSW 1 172369966 missense possibly damaging 0.81
R3826:Kcnj10 UTSW 1 172370049 missense probably damaging 1.00
R4725:Kcnj10 UTSW 1 172369159 missense probably damaging 1.00
R4726:Kcnj10 UTSW 1 172369072 missense probably damaging 1.00
R4727:Kcnj10 UTSW 1 172369699 missense probably damaging 1.00
R5434:Kcnj10 UTSW 1 172369480 missense probably damaging 1.00
R5755:Kcnj10 UTSW 1 172369594 missense possibly damaging 0.81
R6146:Kcnj10 UTSW 1 172369325 nonsense probably null
R7029:Kcnj10 UTSW 1 172368996 missense probably benign 0.07
R7235:Kcnj10 UTSW 1 172369426 missense probably damaging 0.98
R7350:Kcnj10 UTSW 1 172369260 missense possibly damaging 0.52
Z1177:Kcnj10 UTSW 1 172369135 missense possibly damaging 0.86
Z1177:Kcnj10 UTSW 1 172369221 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CGACCTTCATTGACATGCAATGGC -3'
(R):5'- GGAGACTCTTCCGCATATTGGCAAC -3'

Sequencing Primer
(F):5'- GGCGCTACAAGCTTCTGC -3'
(R):5'- TATTGGCAACCCGGATCATAAG -3'
Posted On2014-03-14