Incidental Mutation 'R1424:Lrrc8d'
ID161214
Institutional Source Beutler Lab
Gene Symbol Lrrc8d
Ensembl Gene ENSMUSG00000046079
Gene Nameleucine rich repeat containing 8D
SynonymsLrrc5, 2810473G09Rik, 4930525N13Rik
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105699969-105832436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105826916 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 63 (V63M)
Predicted Effect unknown
Transcript: ENSMUST00000055994
AA Change: V63M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140081
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Lrrc8d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Lrrc8d APN 5 105811952 missense possibly damaging 0.60
IGL01327:Lrrc8d APN 5 105812265 missense probably damaging 1.00
IGL02148:Lrrc8d APN 5 105812387 missense possibly damaging 0.92
IGL02228:Lrrc8d APN 5 105811864 missense probably benign 0.44
IGL02551:Lrrc8d APN 5 105813548 missense possibly damaging 0.78
IGL02605:Lrrc8d APN 5 105826817 intron noncoding transcript
R0415:Lrrc8d UTSW 5 105811865 missense probably damaging 1.00
R1754:Lrrc8d UTSW 5 105812657 missense probably benign
R3411:Lrrc8d UTSW 5 105826706 intron noncoding transcript
R3605:Lrrc8d UTSW 5 105827007 missense unknown
R3705:Lrrc8d UTSW 5 105813475 missense probably damaging 1.00
R3798:Lrrc8d UTSW 5 105812489 missense probably benign 0.12
R3951:Lrrc8d UTSW 5 105814276 missense probably benign 0.00
R4300:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R4953:Lrrc8d UTSW 5 105813368 missense probably damaging 1.00
R5211:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R5436:Lrrc8d UTSW 5 105812552 missense probably damaging 0.98
R5512:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5512:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5514:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5514:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5531:Lrrc8d UTSW 5 105797670 intron probably benign
R5929:Lrrc8d UTSW 5 105812606 missense probably damaging 0.98
R6063:Lrrc8d UTSW 5 105812126 missense probably benign 0.01
R6379:Lrrc8d UTSW 5 105812809 missense probably benign 0.08
R6431:Lrrc8d UTSW 5 105811760 missense probably damaging 1.00
R7127:Lrrc8d UTSW 5 105812963 missense probably damaging 1.00
R7682:Lrrc8d UTSW 5 105812791 missense probably damaging 1.00
R7821:Lrrc8d UTSW 5 105812344 missense probably damaging 1.00
RF003:Lrrc8d UTSW 5 105812641 missense probably damaging 1.00
X0024:Lrrc8d UTSW 5 105811745 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCATAGGAGTTTAACGATGAGCG -3'
(R):5'- AGTGGGCCAGTTAAGGACTTTGC -3'

Sequencing Primer
(F):5'- TTTAACGATGAGCGGGAAGAC -3'
(R):5'- tttgccttttacactggcttc -3'
Posted On2014-03-14