Incidental Mutation 'R1424:Tuba8'
ID161221
Institutional Source Beutler Lab
Gene Symbol Tuba8
Ensembl Gene ENSMUSG00000030137
Gene Nametubulin, alpha 8
Synonyms
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1424 (G1)
Quality Score207
Status Validated
Chromosome6
Chromosomal Location121210696-121226854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121220511 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 44 (N44S)
Ref Sequence ENSEMBL: ENSMUSP00000032233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032233]
Predicted Effect probably benign
Transcript: ENSMUST00000032233
AA Change: N44S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032233
Gene: ENSMUSG00000030137
AA Change: N44S

DomainStartEndE-ValueType
Tubulin 49 246 2.17e-79 SMART
Tubulin_C 248 393 3.76e-56 SMART
low complexity region 441 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124853
Meta Mutation Damage Score 0.0619 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: This gene encodes a member of the tubulin family of cytoskeletal proteins that form the integral component of microtubules. This gene is preferentially expressed in heart, skeletal muscle and testis. The encoded protein may play a role in liver tumorigenesis in mice. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele appear neurologically normal, progress to adulthood and exhibit normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Tuba8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02043:Tuba8 APN 6 121220511 missense probably benign
IGL02725:Tuba8 APN 6 121225957 nonsense probably null
IGL03091:Tuba8 APN 6 121220444 missense probably damaging 1.00
IGL03286:Tuba8 APN 6 121222954 missense possibly damaging 0.67
R0032:Tuba8 UTSW 6 121225904 missense probably benign 0.37
R1624:Tuba8 UTSW 6 121220426 missense probably damaging 1.00
R1741:Tuba8 UTSW 6 121222768 missense possibly damaging 0.95
R1985:Tuba8 UTSW 6 121220520 missense probably benign 0.00
R2513:Tuba8 UTSW 6 121225973 missense probably damaging 1.00
R3160:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R3162:Tuba8 UTSW 6 121222738 missense possibly damaging 0.80
R4074:Tuba8 UTSW 6 121222797 missense probably damaging 1.00
R4875:Tuba8 UTSW 6 121226083 utr 3 prime probably benign
R4968:Tuba8 UTSW 6 121220589 missense probably damaging 1.00
R5073:Tuba8 UTSW 6 121222903 missense probably damaging 0.99
R5444:Tuba8 UTSW 6 121226101 utr 3 prime probably benign
R5546:Tuba8 UTSW 6 121222913 nonsense probably null
R5594:Tuba8 UTSW 6 121225904 missense possibly damaging 0.82
R5619:Tuba8 UTSW 6 121225895 missense probably damaging 0.96
R7366:Tuba8 UTSW 6 121222912 missense probably damaging 1.00
R7489:Tuba8 UTSW 6 121226021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACCCTGTGCATTGGATGTGAG -3'
(R):5'- AGCAGAGACCCTTTTGACCCCTAAC -3'

Sequencing Primer
(F):5'- GCCTGAGTCTGTAGCCAG -3'
(R):5'- GCTCCCCAAGGAGCTAAGAG -3'
Posted On2014-03-14