Incidental Mutation 'R1424:Dock3'
ID161228
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Namededicator of cyto-kinesis 3
SynonymsPBP, Moca
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106892825-107231909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106913193 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 1444 (S1444G)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532] [ENSMUST00000171095]
Predicted Effect probably damaging
Transcript: ENSMUST00000044532
AA Change: S1444G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: S1444G

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166759
Predicted Effect probably benign
Transcript: ENSMUST00000168759
SMART Domains Protein: ENSMUSP00000131410
Gene: ENSMUSG00000039716

DomainStartEndE-ValueType
Pfam:DHR-2 1 241 4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171095
SMART Domains Protein: ENSMUSP00000127059
Gene: ENSMUSG00000039716

DomainStartEndE-ValueType
Pfam:Ded_cyto 1 172 8.9e-52 PFAM
low complexity region 223 234 N/A INTRINSIC
low complexity region 237 248 N/A INTRINSIC
low complexity region 260 275 N/A INTRINSIC
low complexity region 402 424 N/A INTRINSIC
low complexity region 485 499 N/A INTRINSIC
Meta Mutation Damage Score 0.3575 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106911377 splice site probably benign
IGL01067:Dock3 APN 9 107082373 critical splice donor site probably null
IGL01160:Dock3 APN 9 106906688 missense probably damaging 1.00
IGL01290:Dock3 APN 9 106958400 splice site probably benign
IGL01291:Dock3 APN 9 106958400 splice site probably benign
IGL01391:Dock3 APN 9 106907234 missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106993471 missense probably benign 0.06
IGL01660:Dock3 APN 9 107032364 splice site probably benign
IGL01752:Dock3 APN 9 107025313 splice site probably benign
IGL01820:Dock3 APN 9 106895893 missense probably damaging 1.00
IGL01908:Dock3 APN 9 106906662 missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106938141 missense probably benign
IGL02227:Dock3 APN 9 107062055 missense probably damaging 0.98
IGL02309:Dock3 APN 9 106913152 missense probably damaging 1.00
IGL02408:Dock3 APN 9 106913099 splice site probably benign
IGL02469:Dock3 APN 9 106986016 missense probably damaging 0.98
IGL02545:Dock3 APN 9 107062072 missense probably damaging 1.00
IGL02894:Dock3 APN 9 106930099 missense probably benign 0.00
IGL02934:Dock3 APN 9 107023745 missense probably benign 0.01
IGL03027:Dock3 APN 9 106993478 missense probably damaging 0.98
IGL03068:Dock3 APN 9 106964759 missense possibly damaging 0.82
IGL03128:Dock3 APN 9 107032292 missense probably benign 0.05
IGL03161:Dock3 APN 9 107023788 missense probably damaging 0.99
IGL03263:Dock3 APN 9 106930131 splice site probably benign
IGL03279:Dock3 APN 9 106911248 splice site probably benign
IGL03366:Dock3 APN 9 107005433 missense probably benign 0.01
Implosion UTSW 9 106937926 missense probably benign 0.00
Squeeze UTSW 9 106930043 missense probably damaging 1.00
Tight UTSW 9 106994881 missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106895663 missense probably benign
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106912313 missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0206:Dock3 UTSW 9 106996996 nonsense probably null
R0208:Dock3 UTSW 9 106996996 nonsense probably null
R0384:Dock3 UTSW 9 106901895 splice site probably benign
R0610:Dock3 UTSW 9 107023788 missense probably damaging 0.99
R0731:Dock3 UTSW 9 106969856 missense probably damaging 1.00
R1184:Dock3 UTSW 9 106969800 missense probably damaging 1.00
R1350:Dock3 UTSW 9 106914632 missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106911349 missense probably damaging 1.00
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1539:Dock3 UTSW 9 106952364 missense probably damaging 1.00
R1539:Dock3 UTSW 9 106996913 missense probably benign 0.23
R1571:Dock3 UTSW 9 106937959 missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106973841 missense probably damaging 0.98
R1795:Dock3 UTSW 9 107025335 missense probably damaging 0.99
R1987:Dock3 UTSW 9 107108421 missense probably benign 0.01
R2000:Dock3 UTSW 9 106992961 splice site probably benign
R2074:Dock3 UTSW 9 106993463 missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106993544 missense probably benign 0.00
R2265:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2269:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2370:Dock3 UTSW 9 106952355 missense probably damaging 1.00
R2377:Dock3 UTSW 9 106895891 missense probably damaging 0.98
R2385:Dock3 UTSW 9 106991125 missense probably damaging 1.00
R2426:Dock3 UTSW 9 106914541 missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106941526 critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106911343 missense probably damaging 0.99
R4052:Dock3 UTSW 9 106973796 missense probably damaging 0.99
R4294:Dock3 UTSW 9 106930043 missense probably damaging 1.00
R4623:Dock3 UTSW 9 107062045 missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106993544 missense possibly damaging 0.71
R4705:Dock3 UTSW 9 107025336 missense probably damaging 1.00
R4771:Dock3 UTSW 9 106952358 missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106930067 missense probably damaging 1.00
R4898:Dock3 UTSW 9 106992972 missense possibly damaging 0.75
R4948:Dock3 UTSW 9 106991155 missense probably damaging 0.96
R4961:Dock3 UTSW 9 106941316 missense probably damaging 1.00
R4986:Dock3 UTSW 9 106931983 missense probably damaging 1.00
R5054:Dock3 UTSW 9 106937906 missense probably damaging 1.00
R5065:Dock3 UTSW 9 106955684 missense probably damaging 1.00
R5081:Dock3 UTSW 9 106991093 missense probably damaging 1.00
R5101:Dock3 UTSW 9 106969781 missense probably damaging 1.00
R5135:Dock3 UTSW 9 106932997 missense probably damaging 1.00
R5227:Dock3 UTSW 9 106986070 missense probably damaging 1.00
R5257:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5258:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5273:Dock3 UTSW 9 106900705 critical splice donor site probably null
R5322:Dock3 UTSW 9 106901829 missense probably benign 0.14
R5482:Dock3 UTSW 9 106978738 nonsense probably null
R5553:Dock3 UTSW 9 106991110 missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106955699 missense probably benign 0.01
R5739:Dock3 UTSW 9 106973796 missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106895488 missense possibly damaging 0.51
R5888:Dock3 UTSW 9 107023803 missense probably benign 0.12
R5960:Dock3 UTSW 9 106911355 nonsense probably null
R5974:Dock3 UTSW 9 106994062 missense probably damaging 1.00
R6116:Dock3 UTSW 9 106931962 missense probably damaging 1.00
R6162:Dock3 UTSW 9 106964799 missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6219:Dock3 UTSW 9 106994881 missense probably damaging 1.00
R6238:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6266:Dock3 UTSW 9 106964753 missense probably damaging 0.99
R6291:Dock3 UTSW 9 106908432 missense probably benign
R6531:Dock3 UTSW 9 106967216 missense probably benign
R6567:Dock3 UTSW 9 106896747 missense probably benign 0.13
R6572:Dock3 UTSW 9 106989475 missense probably damaging 0.99
R6620:Dock3 UTSW 9 106937926 missense probably benign 0.00
R6726:Dock3 UTSW 9 107159452 nonsense probably null
R7085:Dock3 UTSW 9 106901887 missense probably damaging 1.00
R7151:Dock3 UTSW 9 106964717 missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106895524 missense probably benign 0.20
R7357:Dock3 UTSW 9 107005369 missense probably benign 0.34
R7423:Dock3 UTSW 9 106967171 missense probably damaging 0.98
R7426:Dock3 UTSW 9 106895583 missense probably benign
R7439:Dock3 UTSW 9 107023732 missense probably damaging 1.00
R7452:Dock3 UTSW 9 106989465 missense probably damaging 1.00
R7470:Dock3 UTSW 9 107005445 missense probably damaging 1.00
R7879:Dock3 UTSW 9 106908501 missense probably benign 0.05
R7962:Dock3 UTSW 9 106908501 missense probably benign 0.05
R8047:Dock3 UTSW 9 106993009 missense possibly damaging 0.93
X0023:Dock3 UTSW 9 106985998 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGAGTTCCCAAGAAGCAGGCAC -3'
(R):5'- TGACACTCACTATTGGAGCAGGAGG -3'

Sequencing Primer
(F):5'- CACCTCAGACTTGCTATGGAC -3'
(R):5'- TTCCACCACAGCTCGTAAGG -3'
Posted On2014-03-14