Incidental Mutation 'R1424:Tab2'
ID161229
Institutional Source Beutler Lab
Gene Symbol Tab2
Ensembl Gene ENSMUSG00000015755
Gene NameTGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms1110030N06Rik, Map3k7ip2, A530078N03Rik, Tak1 binding protein 2
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7905653-7956230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 7920048 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 149 (S149R)
Ref Sequence ENSEMBL: ENSMUSP00000122559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130322] [ENSMUST00000146444] [ENSMUST00000147938]
Predicted Effect possibly damaging
Transcript: ENSMUST00000130322
AA Change: S149R

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122559
Gene: ENSMUSG00000015755
AA Change: S149R

DomainStartEndE-ValueType
low complexity region 212 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146444
AA Change: S223R

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000121266
Gene: ENSMUSG00000015755
AA Change: S223R

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
coiled coil region 532 619 N/A INTRINSIC
ZnF_RBZ 666 690 1.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147938
AA Change: S223R

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119515
Gene: ENSMUSG00000015755
AA Change: S223R

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of MAP3K7/TAK1, which is required for for the IL-1 induced activation of nuclear factor kappaB and MAPK8/JNK. This protein forms a kinase complex with TRAF6, MAP3K7 and TAB1, and it thus serves as an adaptor that links MAP3K7 and TRAF6. This protein, along with TAB1 and MAP3K7, also participates in the signal transduction induced by TNFSF11/RANKl through the activation of the receptor activator of NF-kappaB (TNFRSF11A/RANK), which may regulate the development and function of osteoclasts. Studies of the related mouse protein indicate that it functions to protect against liver damage caused by chemical stressors. Mutations in this gene cause congenital heart defects, multiple types, 2 (CHTD2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are viable up to E9.5. Embryos homozygous for a different knock-out allele are normal and viable up to E11.5 but become pale and anemic, exhibit liver hemorrhage and increased apoptosis of hepatoblasts, and die by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Tab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Tab2 APN 10 7910073 missense probably benign 0.21
IGL01316:Tab2 APN 10 7924704 missense probably damaging 1.00
IGL01902:Tab2 APN 10 7919992 missense probably benign 0.12
IGL03338:Tab2 APN 10 7919275 missense probably damaging 1.00
Cosmo UTSW 10 7924719 missense probably damaging 1.00
Cosmo-2 UTSW 10 7907481 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0068:Tab2 UTSW 10 7919677 missense probably damaging 1.00
R0271:Tab2 UTSW 10 7919158 missense probably benign
R0458:Tab2 UTSW 10 7919555 missense probably damaging 1.00
R0608:Tab2 UTSW 10 7920119 missense probably damaging 0.99
R0632:Tab2 UTSW 10 7919801 missense probably benign 0.07
R0744:Tab2 UTSW 10 7907581 unclassified probably benign
R1162:Tab2 UTSW 10 7924719 missense probably damaging 1.00
R1954:Tab2 UTSW 10 7919330 missense probably damaging 1.00
R2516:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R2518:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R2520:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R3418:Tab2 UTSW 10 7907481 missense probably damaging 1.00
R4081:Tab2 UTSW 10 7919831 missense probably damaging 1.00
R4177:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R4178:Tab2 UTSW 10 7919359 missense probably damaging 1.00
R5410:Tab2 UTSW 10 7919821 missense possibly damaging 0.86
R5681:Tab2 UTSW 10 7920073 missense probably damaging 1.00
R5683:Tab2 UTSW 10 7919112 critical splice donor site probably null
R6857:Tab2 UTSW 10 7920413 missense possibly damaging 0.50
R7424:Tab2 UTSW 10 7907483 missense probably damaging 1.00
R7692:Tab2 UTSW 10 7911105 missense probably damaging 1.00
R7790:Tab2 UTSW 10 7920424 missense probably damaging 1.00
R7792:Tab2 UTSW 10 7919133 missense possibly damaging 0.50
Z1088:Tab2 UTSW 10 7920266 missense possibly damaging 0.88
Z1177:Tab2 UTSW 10 7919179 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TAGACATGAGAGGTCTGATGGCCC -3'
(R):5'- ACGAACTGTTTCAGCAAGAGCCAC -3'

Sequencing Primer
(F):5'- ATGGCCCTGCTGATTCG -3'
(R):5'- TGGAATGCCCAGTACATCTG -3'
Posted On2014-03-14