Incidental Mutation 'R1424:Taok1'
ID161233
Institutional Source Beutler Lab
Gene Symbol Taok1
Ensembl Gene ENSMUSG00000017291
Gene NameTAO kinase 1
SynonymsD130018F14Rik, 2810468K05Rik
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.581) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location77529162-77607815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 77549364 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 606 (R606S)
Ref Sequence ENSEMBL: ENSMUSP00000055470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017435] [ENSMUST00000058496]
Predicted Effect probably benign
Transcript: ENSMUST00000017435
AA Change: R606S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000017435
Gene: ENSMUSG00000017291
AA Change: R606S

DomainStartEndE-ValueType
S_TKc 28 281 3.26e-87 SMART
low complexity region 327 335 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
coiled coil region 458 651 N/A INTRINSIC
coiled coil region 792 878 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058496
AA Change: R606S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000055470
Gene: ENSMUSG00000017291
AA Change: R606S

DomainStartEndE-ValueType
S_TKc 28 281 3.26e-87 SMART
low complexity region 327 335 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
coiled coil region 458 651 N/A INTRINSIC
coiled coil region 792 878 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
Meta Mutation Damage Score 0.0630 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Taok1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Taok1 APN 11 77571684 missense probably damaging 1.00
IGL01629:Taok1 APN 11 77538204 missense possibly damaging 0.63
IGL02198:Taok1 APN 11 77575677 splice site probably benign
IGL02392:Taok1 APN 11 77549352 missense probably benign 0.13
IGL02415:Taok1 APN 11 77540240 unclassified probably benign
IGL02428:Taok1 APN 11 77549277 missense probably benign 0.01
IGL02972:Taok1 APN 11 77559758 missense probably benign 0.04
IGL03200:Taok1 APN 11 77575652 nonsense probably null
IGL03203:Taok1 APN 11 77540085 missense probably damaging 0.96
IGL03292:Taok1 APN 11 77540136 missense probably benign 0.07
IGL03351:Taok1 APN 11 77560328 missense probably damaging 0.96
R0070:Taok1 UTSW 11 77553717 missense probably benign
R0497:Taok1 UTSW 11 77573804 missense probably damaging 0.97
R0535:Taok1 UTSW 11 77553704 missense probably benign 0.00
R0558:Taok1 UTSW 11 77559844 missense possibly damaging 0.89
R0653:Taok1 UTSW 11 77578724 critical splice donor site probably null
R1249:Taok1 UTSW 11 77571637 missense probably damaging 1.00
R1597:Taok1 UTSW 11 77579800 missense probably benign 0.31
R2112:Taok1 UTSW 11 77571646 missense probably benign 0.01
R3716:Taok1 UTSW 11 77541810 missense probably benign 0.09
R4013:Taok1 UTSW 11 77559833 missense possibly damaging 0.95
R4058:Taok1 UTSW 11 77549438 missense probably benign 0.05
R4831:Taok1 UTSW 11 77553674 missense probably null 0.34
R5036:Taok1 UTSW 11 77549331 missense probably benign 0.01
R5917:Taok1 UTSW 11 77560318 missense probably damaging 0.99
R6271:Taok1 UTSW 11 77573783 missense probably damaging 1.00
R6286:Taok1 UTSW 11 77553773 missense probably benign 0.00
R6860:Taok1 UTSW 11 77541801 missense probably benign 0.01
R6933:Taok1 UTSW 11 77555653 missense probably benign
R7139:Taok1 UTSW 11 77571633 missense probably damaging 1.00
R7143:Taok1 UTSW 11 77537988 missense probably benign
R7305:Taok1 UTSW 11 77541674 nonsense probably null
R7340:Taok1 UTSW 11 77579817 missense possibly damaging 0.89
R7508:Taok1 UTSW 11 77545326 missense probably damaging 0.97
R7569:Taok1 UTSW 11 77555614 missense probably benign 0.06
R7753:Taok1 UTSW 11 77537899 missense probably benign 0.29
R8064:Taok1 UTSW 11 77549304 nonsense probably null
Z1176:Taok1 UTSW 11 77559926 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCAGAAGGATTTACAGAGTAAGGCATT -3'
(R):5'- CATTCAAGACATTTTGAAagccaggcat -3'

Sequencing Primer
(F):5'- TTACAGAGTAAGGCATTGCTGAAAAC -3'
(R):5'- gagccatctctcaagccc -3'
Posted On2014-03-14