Incidental Mutation 'R1424:4930447C04Rik'
ID161237
Institutional Source Beutler Lab
Gene Symbol 4930447C04Rik
Ensembl Gene ENSMUSG00000021098
Gene NameRIKEN cDNA 4930447C04 gene
SynonymsSix6as, Six6os1
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location72881109-72940774 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 72892895 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 415 (E415*)
Ref Sequence ENSEMBL: ENSMUSP00000106115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044000] [ENSMUST00000110489]
Predicted Effect probably null
Transcript: ENSMUST00000044000
AA Change: E414*
SMART Domains Protein: ENSMUSP00000035376
Gene: ENSMUSG00000021098
AA Change: E414*

DomainStartEndE-ValueType
low complexity region 137 147 N/A INTRINSIC
coiled coil region 197 233 N/A INTRINSIC
low complexity region 247 261 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 522 534 N/A INTRINSIC
low complexity region 552 565 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110489
AA Change: E415*
SMART Domains Protein: ENSMUSP00000106115
Gene: ENSMUSG00000021098
AA Change: E415*

DomainStartEndE-ValueType
Pfam:S6OS1 31 575 1.1e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132901
Predicted Effect probably benign
Transcript: ENSMUST00000143960
SMART Domains Protein: ENSMUSP00000116391
Gene: ENSMUSG00000021098

DomainStartEndE-ValueType
Pfam:S6OS1 1 70 6.1e-21 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with meiotic arrest and defective synaptic formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam227a T A 15: 79,634,108 I328F probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in 4930447C04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:4930447C04Rik APN 12 72881386 missense possibly damaging 0.71
IGL01611:4930447C04Rik APN 12 72907870 missense possibly damaging 0.93
IGL02352:4930447C04Rik APN 12 72895055 splice site probably null
IGL02359:4930447C04Rik APN 12 72895055 splice site probably null
FR4304:4930447C04Rik UTSW 12 72881287 small deletion probably benign
R0650:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R0651:4930447C04Rik UTSW 12 72910056 missense probably damaging 0.99
R1271:4930447C04Rik UTSW 12 72892883 missense possibly damaging 0.71
R1321:4930447C04Rik UTSW 12 72898544 splice site probably benign
R1387:4930447C04Rik UTSW 12 72915434 missense probably benign 0.04
R1440:4930447C04Rik UTSW 12 72881421 missense possibly damaging 0.85
R1538:4930447C04Rik UTSW 12 72881346 missense possibly damaging 0.92
R1694:4930447C04Rik UTSW 12 72885218 splice site probably null
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R1888:4930447C04Rik UTSW 12 72913256 missense unknown
R2151:4930447C04Rik UTSW 12 72907951 splice site probably null
R4930:4930447C04Rik UTSW 12 72906234 missense possibly damaging 0.71
R4967:4930447C04Rik UTSW 12 72909728 nonsense probably null
R5243:4930447C04Rik UTSW 12 72909769 critical splice donor site probably null
R6312:4930447C04Rik UTSW 12 72889767 missense possibly damaging 0.86
R6825:4930447C04Rik UTSW 12 72907880 missense probably benign 0.32
R7275:4930447C04Rik UTSW 12 72910021 missense possibly damaging 0.71
RF041:4930447C04Rik UTSW 12 72881276 small deletion probably benign
Z1088:4930447C04Rik UTSW 12 72939395 unclassified probably benign
Z1176:4930447C04Rik UTSW 12 72916726 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- ACCCCAACCATCAGAAAGacaaacaa -3'
(R):5'- acctgtgacacAGATCCAGATTATAGCA -3'

Sequencing Primer
(F):5'- acaaacaagcaaacaaacaaaaaac -3'
(R):5'- cacAGATCCAGATTATAGCATAAAGC -3'
Posted On2014-03-14