Incidental Mutation 'R1424:Fam227a'
ID161244
Institutional Source Beutler Lab
Gene Symbol Fam227a
Ensembl Gene ENSMUSG00000042564
Gene Namefamily with sequence similarity 227, member A
Synonyms4933432B09Rik
MMRRC Submission 039480-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R1424 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79609576-79658956 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79634108 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 328 (I328F)
Ref Sequence ENSEMBL: ENSMUSP00000155261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109646] [ENSMUST00000109648] [ENSMUST00000187519] [ENSMUST00000191401] [ENSMUST00000229064] [ENSMUST00000230366]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000046816
SMART Domains Protein: ENSMUSP00000048277
Gene: ENSMUSG00000042564

DomainStartEndE-ValueType
Pfam:FWWh 128 242 6.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109646
SMART Domains Protein: ENSMUSP00000105273
Gene: ENSMUSG00000042564

DomainStartEndE-ValueType
low complexity region 156 175 N/A INTRINSIC
low complexity region 204 211 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109648
AA Change: I332F

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105275
Gene: ENSMUSG00000042564
AA Change: I332F

DomainStartEndE-ValueType
Pfam:FWWh 134 295 1.4e-51 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187519
AA Change: I332F

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139524
Gene: ENSMUSG00000042564
AA Change: I332F

DomainStartEndE-ValueType
Pfam:FWWh 132 295 1e-47 PFAM
low complexity region 512 531 N/A INTRINSIC
low complexity region 560 567 N/A INTRINSIC
low complexity region 599 609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191401
Predicted Effect probably benign
Transcript: ENSMUST00000229064
AA Change: I328F

PolyPhen 2 Score 0.337 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000230366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230475
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447C04Rik C A 12: 72,892,895 E415* probably null Het
8430408G22Rik A G 6: 116,652,005 N103S possibly damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Acad12 C T 5: 121,604,322 A408T probably benign Het
Acox2 T A 14: 8,230,247 H632L probably benign Het
Anxa5 A T 3: 36,452,292 probably null Het
Ap1m2 A T 9: 21,298,204 I392N possibly damaging Het
Casp2 T C 6: 42,276,791 probably benign Het
Cel C T 2: 28,559,624 A243T probably damaging Het
Dgka A T 10: 128,733,333 S177T possibly damaging Het
Dnajc6 A G 4: 101,639,347 T836A possibly damaging Het
Dock3 T C 9: 106,913,193 S1444G probably damaging Het
Dtl T C 1: 191,561,537 D176G probably benign Het
Eif4g1 T C 16: 20,678,942 I230T probably benign Het
Fam98a A G 17: 75,540,178 L179S probably damaging Het
Fgb A T 3: 83,046,763 I56N probably damaging Het
Fmo1 C T 1: 162,830,066 R502Q probably damaging Het
Fndc3a C T 14: 72,574,371 A340T probably damaging Het
Gli3 C A 13: 15,726,314 Q1429K probably benign Het
Gm3443 A T 19: 21,557,595 I75F possibly damaging Het
Gtpbp6 C T 5: 110,104,289 probably null Het
Gtsf1 A T 15: 103,409,643 Y156* probably null Het
Hmcn1 T C 1: 150,646,794 T3452A probably benign Het
Kcnj10 T A 1: 172,369,255 V112E probably damaging Het
Lama3 C A 18: 12,519,991 T256K probably benign Het
Lrrc8d G A 5: 105,826,916 V63M unknown Het
Matn3 G T 12: 8,961,132 A348S possibly damaging Het
Mmp16 A G 4: 18,112,121 probably null Het
Nsd3 A G 8: 25,700,566 N175S probably damaging Het
Olfr1260 C T 2: 89,978,071 Q98* probably null Het
Olfr412 C A 11: 74,364,954 P95Q probably benign Het
Olfr729 C A 14: 50,148,465 M136I possibly damaging Het
Olfr749 A T 14: 50,737,064 F33I probably benign Het
Pcdhb12 T A 18: 37,438,079 N759K probably benign Het
Pcsk2 T C 2: 143,573,428 probably benign Het
Polq G A 16: 37,086,528 D2284N probably damaging Het
Prdm12 C T 2: 31,643,811 R147C probably damaging Het
Ptprz1 A G 6: 23,000,383 D824G probably benign Het
Rere C T 4: 150,617,038 R1292C probably damaging Het
Rptor T A 11: 119,780,593 L294* probably null Het
Sbf2 A T 7: 110,315,026 C1650S probably damaging Het
Sdk1 C T 5: 142,161,866 T1751I probably damaging Het
Sh3bp1 T C 15: 78,903,699 probably null Het
Shank2 T A 7: 144,052,372 D97E probably damaging Het
Tab2 A C 10: 7,920,048 S149R possibly damaging Het
Taok1 G T 11: 77,549,364 R606S probably benign Het
Tas2r121 A G 6: 132,700,682 L109P probably damaging Het
Tmem117 A G 15: 94,931,808 M175V probably benign Het
Tmprss11b T C 5: 86,664,973 K155E probably benign Het
Tmtc2 G T 10: 105,413,368 T168N probably benign Het
Top2b G A 14: 16,383,177 R55H probably damaging Het
Tsga10ip C T 19: 5,390,914 probably null Het
Tuba8 A G 6: 121,220,511 N44S probably benign Het
Ube2o A G 11: 116,543,732 V590A probably benign Het
Ush2a T G 1: 188,542,878 probably null Het
Vmn2r23 T A 6: 123,713,270 Y368* probably null Het
Other mutations in Fam227a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Fam227a APN 15 79634073 missense possibly damaging 0.66
IGL01807:Fam227a APN 15 79649655 missense probably benign 0.03
IGL01936:Fam227a APN 15 79612546 missense possibly damaging 0.90
IGL02355:Fam227a APN 15 79643938 intron probably benign
IGL02362:Fam227a APN 15 79643938 intron probably benign
IGL02569:Fam227a APN 15 79634122 missense probably benign
IGL02713:Fam227a APN 15 79636796 splice site probably benign
IGL02734:Fam227a APN 15 79617841 splice site probably benign
IGL02816:Fam227a APN 15 79626296 missense possibly damaging 0.66
IGL03354:Fam227a APN 15 79636750 missense possibly damaging 0.91
R0105:Fam227a UTSW 15 79620832 missense possibly damaging 0.90
R0194:Fam227a UTSW 15 79640669 nonsense probably null
R0437:Fam227a UTSW 15 79643988 missense possibly damaging 0.90
R0786:Fam227a UTSW 15 79626268 missense probably benign 0.01
R0925:Fam227a UTSW 15 79620805 missense probably benign 0.04
R1200:Fam227a UTSW 15 79612537 missense possibly damaging 0.66
R1474:Fam227a UTSW 15 79615381 missense probably damaging 0.97
R1495:Fam227a UTSW 15 79626245 missense probably benign 0.00
R1561:Fam227a UTSW 15 79636762 missense possibly damaging 0.95
R1661:Fam227a UTSW 15 79620677 intron probably null
R1669:Fam227a UTSW 15 79620677 intron probably null
R1967:Fam227a UTSW 15 79637134 missense possibly damaging 0.93
R1976:Fam227a UTSW 15 79626276 missense possibly damaging 0.83
R2197:Fam227a UTSW 15 79623467 missense probably damaging 0.97
R2230:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2231:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2232:Fam227a UTSW 15 79615381 missense possibly damaging 0.66
R2910:Fam227a UTSW 15 79636734 missense possibly damaging 0.81
R3027:Fam227a UTSW 15 79648733 splice site probably null
R3943:Fam227a UTSW 15 79620859 splice site probably benign
R4811:Fam227a UTSW 15 79615427 missense possibly damaging 0.66
R4845:Fam227a UTSW 15 79649711 missense probably damaging 0.99
R4896:Fam227a UTSW 15 79637054 missense probably benign 0.32
R4934:Fam227a UTSW 15 79637061 missense possibly damaging 0.71
R4941:Fam227a UTSW 15 79640003 critical splice donor site probably null
R5225:Fam227a UTSW 15 79636735 missense possibly damaging 0.90
R5369:Fam227a UTSW 15 79615436 missense probably benign 0.27
R5593:Fam227a UTSW 15 79640058 utr 3 prime probably benign
R6311:Fam227a UTSW 15 79640694 missense probably benign 0.23
R6362:Fam227a UTSW 15 79643350 missense possibly damaging 0.53
R6532:Fam227a UTSW 15 79636720 missense probably benign 0.00
R7239:Fam227a UTSW 15 79634062 critical splice donor site probably null
R7619:Fam227a UTSW 15 79617766 missense probably benign
R7719:Fam227a UTSW 15 79620712 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ATCAGGCCCCACTCTGAGGAAATG -3'
(R):5'- CACTGTGAACTGTAGCCTTGTGGAC -3'

Sequencing Primer
(F):5'- CCCACTCTGAGGAAATGGGATAG -3'
(R):5'- GAACTGTAGCCTTGTGGACATTATTC -3'
Posted On2014-03-14