Incidental Mutation 'R1425:Ppm1k'
ID 161256
Institutional Source Beutler Lab
Gene Symbol Ppm1k
Ensembl Gene ENSMUSG00000037826
Gene Name protein phosphatase 1K (PP2C domain containing)
Synonyms PP2Cm, 2900063A19Rik, A930026L03Rik
MMRRC Submission 039481-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R1425 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 57483487-57512453 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 57501774 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 130 (G130R)
Ref Sequence ENSEMBL: ENSMUSP00000041395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042766]
AlphaFold Q8BXN7
Predicted Effect probably damaging
Transcript: ENSMUST00000042766
AA Change: G130R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041395
Gene: ENSMUSG00000037826
AA Change: G130R

DomainStartEndE-ValueType
PP2Cc 88 344 2.16e-68 SMART
PP2C_SIG 93 346 1.15e-3 SMART
low complexity region 359 368 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204686
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PPM family of Mn2+/Mg2+-dependent protein phosphatases. The encoded protein, essential for cell survival and development, is targeted to the mitochondria where it plays a key role in regulation of the mitochondrial permeability transition pore. [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit defective amino acid metabolism, increased oxidative stress, and increased mortality when subjected to a high-protein diet while in utero and during postnatal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6ap1l T C 13: 91,047,638 (GRCm39) N58S possibly damaging Het
Gdpd4 A T 7: 97,623,219 (GRCm39) T277S probably benign Het
Itgb2 G A 10: 77,383,130 (GRCm39) G167S probably null Het
Kcnt2 A G 1: 140,310,766 (GRCm39) T191A probably damaging Het
Or52b1 A T 7: 104,978,922 (GRCm39) F159Y probably damaging Het
Rfc1 A C 5: 65,476,861 (GRCm39) F6V probably damaging Het
Sec14l3 A G 11: 4,016,487 (GRCm39) E53G probably damaging Het
Tas2r115 T G 6: 132,714,442 (GRCm39) S170R probably benign Het
Zfp738 T C 13: 67,818,894 (GRCm39) T366A possibly damaging Het
Other mutations in Ppm1k
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Ppm1k APN 6 57,501,740 (GRCm39) missense probably benign 0.05
IGL01395:Ppm1k APN 6 57,490,943 (GRCm39) missense probably benign
IGL01923:Ppm1k APN 6 57,499,813 (GRCm39) missense probably benign 0.01
IGL02484:Ppm1k APN 6 57,501,997 (GRCm39) missense possibly damaging 0.59
IGL03149:Ppm1k APN 6 57,501,759 (GRCm39) missense probably damaging 0.99
IGL03340:Ppm1k APN 6 57,487,711 (GRCm39) missense probably damaging 1.00
R1230:Ppm1k UTSW 6 57,502,059 (GRCm39) missense probably benign
R1522:Ppm1k UTSW 6 57,502,142 (GRCm39) missense possibly damaging 0.48
R3508:Ppm1k UTSW 6 57,491,975 (GRCm39) missense probably damaging 0.99
R3751:Ppm1k UTSW 6 57,501,845 (GRCm39) missense probably benign 0.01
R4845:Ppm1k UTSW 6 57,499,753 (GRCm39) nonsense probably null
R4914:Ppm1k UTSW 6 57,487,762 (GRCm39) missense probably damaging 0.99
R4915:Ppm1k UTSW 6 57,487,762 (GRCm39) missense probably damaging 0.99
R4918:Ppm1k UTSW 6 57,487,762 (GRCm39) missense probably damaging 0.99
R5430:Ppm1k UTSW 6 57,501,871 (GRCm39) nonsense probably null
R6907:Ppm1k UTSW 6 57,487,755 (GRCm39) missense probably benign 0.01
R6962:Ppm1k UTSW 6 57,492,645 (GRCm39) missense probably damaging 0.99
R7943:Ppm1k UTSW 6 57,501,813 (GRCm39) missense probably benign 0.14
R8834:Ppm1k UTSW 6 57,502,023 (GRCm39) missense probably benign 0.01
R9461:Ppm1k UTSW 6 57,487,720 (GRCm39) missense probably damaging 1.00
R9606:Ppm1k UTSW 6 57,491,057 (GRCm39) missense possibly damaging 0.72
R9684:Ppm1k UTSW 6 57,487,762 (GRCm39) missense probably damaging 0.99
R9711:Ppm1k UTSW 6 57,492,720 (GRCm39) missense probably damaging 1.00
X0024:Ppm1k UTSW 6 57,490,995 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTACCATTCTCTGATGAAGTGGCA -3'
(R):5'- TTGATCCAGATGGAAGTGGGCAGC -3'

Sequencing Primer
(F):5'- CTCTGATGAAGTGGCATGTGG -3'
(R):5'- CAGCCACTTGGGACAATTTTG -3'
Posted On 2014-03-14