Incidental Mutation 'R1425:Or52b1'
ID 161259
Institutional Source Beutler Lab
Gene Symbol Or52b1
Ensembl Gene ENSMUSG00000050266
Gene Name olfactory receptor family 52 subfamily B member 1
Synonyms Olfr690, GA_x6K02T2PBJ9-7959171-7958224, MOR31-2
MMRRC Submission 039481-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R1425 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 104978424-104979485 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 104978922 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 159 (F159Y)
Ref Sequence ENSEMBL: ENSMUSP00000150831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061920] [ENSMUST00000211006] [ENSMUST00000216230]
AlphaFold Q8VH18
Predicted Effect probably damaging
Transcript: ENSMUST00000061920
AA Change: F159Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061272
Gene: ENSMUSG00000050266
AA Change: F159Y

DomainStartEndE-ValueType
transmembrane domain 2 19 N/A INTRINSIC
Pfam:7tm_4 33 312 2e-110 PFAM
Pfam:7TM_GPCR_Srsx 37 264 1.4e-9 PFAM
Pfam:7tm_1 43 294 1.7e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209868
Predicted Effect probably damaging
Transcript: ENSMUST00000211006
AA Change: F159Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216230
AA Change: F159Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.4%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 9 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp6ap1l T C 13: 91,047,638 (GRCm39) N58S possibly damaging Het
Gdpd4 A T 7: 97,623,219 (GRCm39) T277S probably benign Het
Itgb2 G A 10: 77,383,130 (GRCm39) G167S probably null Het
Kcnt2 A G 1: 140,310,766 (GRCm39) T191A probably damaging Het
Ppm1k C T 6: 57,501,774 (GRCm39) G130R probably damaging Het
Rfc1 A C 5: 65,476,861 (GRCm39) F6V probably damaging Het
Sec14l3 A G 11: 4,016,487 (GRCm39) E53G probably damaging Het
Tas2r115 T G 6: 132,714,442 (GRCm39) S170R probably benign Het
Zfp738 T C 13: 67,818,894 (GRCm39) T366A possibly damaging Het
Other mutations in Or52b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Or52b1 APN 7 104,978,589 (GRCm39) missense possibly damaging 0.95
IGL01403:Or52b1 APN 7 104,978,605 (GRCm39) missense probably benign 0.01
IGL01546:Or52b1 APN 7 104,978,899 (GRCm39) missense probably damaging 1.00
IGL02936:Or52b1 APN 7 104,979,212 (GRCm39) nonsense probably null
R0206:Or52b1 UTSW 7 104,979,090 (GRCm39) missense possibly damaging 0.76
R0206:Or52b1 UTSW 7 104,979,090 (GRCm39) missense possibly damaging 0.76
R1911:Or52b1 UTSW 7 104,978,590 (GRCm39) missense probably benign 0.11
R2126:Or52b1 UTSW 7 104,978,459 (GRCm39) nonsense probably null
R2511:Or52b1 UTSW 7 104,978,817 (GRCm39) missense probably damaging 1.00
R2919:Or52b1 UTSW 7 104,979,067 (GRCm39) missense probably damaging 1.00
R3755:Or52b1 UTSW 7 104,979,358 (GRCm39) missense probably damaging 1.00
R4152:Or52b1 UTSW 7 104,978,592 (GRCm39) missense probably damaging 1.00
R4153:Or52b1 UTSW 7 104,978,592 (GRCm39) missense probably damaging 1.00
R4154:Or52b1 UTSW 7 104,978,592 (GRCm39) missense probably damaging 1.00
R4247:Or52b1 UTSW 7 104,979,355 (GRCm39) missense probably benign
R5015:Or52b1 UTSW 7 104,978,811 (GRCm39) missense possibly damaging 0.61
R5143:Or52b1 UTSW 7 104,978,731 (GRCm39) missense probably damaging 1.00
R5642:Or52b1 UTSW 7 104,978,772 (GRCm39) missense probably damaging 1.00
R6747:Or52b1 UTSW 7 104,979,234 (GRCm39) missense probably benign 0.00
R6961:Or52b1 UTSW 7 104,978,913 (GRCm39) missense probably damaging 1.00
R7074:Or52b1 UTSW 7 104,978,475 (GRCm39) missense probably benign 0.44
R8066:Or52b1 UTSW 7 104,978,761 (GRCm39) missense possibly damaging 0.87
R9273:Or52b1 UTSW 7 104,978,646 (GRCm39) missense probably damaging 1.00
R9314:Or52b1 UTSW 7 104,979,081 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCCATTGGCACCGAGAAG -3'
(R):5'- CTGTCAACCACCACTGTGCCTAAG -3'

Sequencing Primer
(F):5'- GCCATACCAGATATTGACAGTGATG -3'
(R):5'- ATGCCTGCATTGCTCAGATG -3'
Posted On 2014-03-14