Incidental Mutation 'R1437:Nr1i3'
Institutional Source Beutler Lab
Gene Symbol Nr1i3
Ensembl Gene ENSMUSG00000005677
Gene Namenuclear receptor subfamily 1, group I, member 3
SynonymsCare2, CAR1, mCAR, CAR, ESTM32, MB67
MMRRC Submission 039492-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1437 (G1)
Quality Score118
Status Not validated
Chromosomal Location171213970-171220701 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CACTCAACACTAC to CAC at 171217141 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005817] [ENSMUST00000005820] [ENSMUST00000075469] [ENSMUST00000111326] [ENSMUST00000111327] [ENSMUST00000111328] [ENSMUST00000133075] [ENSMUST00000155126] [ENSMUST00000138184] [ENSMUST00000143405] [ENSMUST00000147246]
Predicted Effect probably benign
Transcript: ENSMUST00000005817
SMART Domains Protein: ENSMUSP00000005817
Gene: ENSMUSG00000005674

Pfam:Porin_3 26 302 7.2e-76 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000005820
SMART Domains Protein: ENSMUSP00000005820
Gene: ENSMUSG00000005677

ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 333 5.55e-29 SMART
Predicted Effect probably null
Transcript: ENSMUST00000075469
SMART Domains Protein: ENSMUSP00000074915
Gene: ENSMUSG00000005677

ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 285 8.9e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111326
SMART Domains Protein: ENSMUSP00000106958
Gene: ENSMUSG00000005674

Pfam:Porin_3 26 95 9e-16 PFAM
Pfam:Porin_3 85 268 1.4e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111327
SMART Domains Protein: ENSMUSP00000106959
Gene: ENSMUSG00000005674

Pfam:Porin_3 26 302 3.4e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111328
SMART Domains Protein: ENSMUSP00000106960
Gene: ENSMUSG00000005677

ZnF_C4 18 89 6.98e-35 SMART
low complexity region 94 110 N/A INTRINSIC
HOLI 173 332 5.55e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130529
Predicted Effect probably benign
Transcript: ENSMUST00000133075
SMART Domains Protein: ENSMUSP00000137852
Gene: ENSMUSG00000005677

ZnF_C4 18 58 1.68e-3 SMART
low complexity region 80 93 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137298
Predicted Effect probably null
Transcript: ENSMUST00000155126
SMART Domains Protein: ENSMUSP00000137683
Gene: ENSMUSG00000005677

HOLI 36 196 5.55e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149404
Predicted Effect probably benign
Transcript: ENSMUST00000138184
SMART Domains Protein: ENSMUSP00000115877
Gene: ENSMUSG00000005674

Pfam:Porin_3 26 119 1.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143405
Predicted Effect probably benign
Transcript: ENSMUST00000147246
SMART Domains Protein: ENSMUSP00000119006
Gene: ENSMUSG00000005674

Pfam:Porin_3 26 91 5e-16 PFAM
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nuclear receptor superfamily, and is a key regulator of xenobiotic and endobiotic metabolism. The protein binds to DNA as a monomer or a heterodimer with the retinoid X receptor and regulates the transcription of target genes involved in drug metabolism and bilirubin clearance, such as cytochrome P450 family members. Unlike most nuclear receptors, this transcriptional regulator is constitutively active in the absence of ligand but is regulated by both agonists and inverse agonists. Ligand binding results in translocation of this protein to the nucleus, where it activates or represses target gene transcription. These ligands include bilirubin, a variety of foreign compounds, steroid hormones, and prescription drugs. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased sensitivity to TCPOBOP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C A 3: 36,942,429 H1097N possibly damaging Het
Abcb1b T A 5: 8,821,436 V330E possibly damaging Het
Abcb5 A G 12: 118,874,762 S1022P probably damaging Het
Abcc8 A G 7: 46,179,813 I46T probably damaging Het
Add3 A G 19: 53,233,678 R275G probably damaging Het
Akap1 C A 11: 88,844,751 G362* probably null Het
Arhgef4 A G 1: 34,723,945 T761A unknown Het
Asap1 A T 15: 64,120,107 L751Q probably damaging Het
Atg2a C A 19: 6,250,616 P741H probably damaging Het
Atxn10 T C 15: 85,359,474 I46T possibly damaging Het
BC049715 C A 6: 136,840,092 A110E probably damaging Het
Btbd7 T A 12: 102,788,090 T806S possibly damaging Het
Cdk4 C A 10: 127,064,689 P108H probably damaging Het
Cep290 A G 10: 100,572,101 T2391A probably benign Het
Col6a3 G T 1: 90,801,376 A1281E probably damaging Het
Cpa5 A T 6: 30,624,655 I165F probably damaging Het
Ctdp1 G T 18: 80,450,213 Q356K probably benign Het
Ddx21 A G 10: 62,598,590 M130T unknown Het
Epha5 T G 5: 84,233,696 D432A probably damaging Het
Fads2 A T 19: 10,091,829 L77Q probably benign Het
Fbn2 A T 18: 58,053,659 H1723Q possibly damaging Het
Fbxo42 C T 4: 141,167,854 H43Y probably benign Het
Fry A G 5: 150,310,425 T121A possibly damaging Het
Gpr156 T G 16: 37,988,542 S209A probably damaging Het
Hey2 T C 10: 30,833,849 T303A probably benign Het
Hivep1 T A 13: 42,157,140 M952K probably benign Het
Hrasls C A 16: 29,228,170 A147E possibly damaging Het
Hydin C T 8: 110,581,985 Q3968* probably null Het
Jup T C 11: 100,383,576 E96G probably benign Het
Kcnn1 A G 8: 70,844,551 I504T probably benign Het
Klk1b9 T C 7: 43,979,690 V174A probably damaging Het
Lama3 G C 18: 12,549,227 M1083I possibly damaging Het
Lcmt2 A G 2: 121,138,896 S569P probably benign Het
Lrfn2 T C 17: 49,071,225 S445P probably damaging Het
Lrp3 C A 7: 35,213,170 G31W probably damaging Het
Lrrc8b T C 5: 105,481,702 L638P probably damaging Het
Mief2 C T 11: 60,730,943 T113M probably benign Het
Mrps2 T C 2: 28,468,887 F76S probably damaging Het
Naca A G 10: 128,042,179 probably benign Het
Ndst4 C A 3: 125,561,450 R336S probably damaging Het
Nr5a1 T A 2: 38,710,673 T29S probably benign Het
Olfr1111 C T 2: 87,149,771 V297M possibly damaging Het
Olfr993 T C 2: 85,414,874 I2V probably benign Het
Pald1 A G 10: 61,341,285 F662S possibly damaging Het
Pdcd4 G T 19: 53,909,243 A59S probably damaging Het
Pde4a T C 9: 21,192,592 probably null Het
Pkd1 T A 17: 24,595,132 S4159T probably damaging Het
Plch1 C A 3: 63,697,533 R1641L probably benign Het
Plec G T 15: 76,189,281 P308Q probably damaging Het
Pnkp A G 7: 44,860,402 S262G possibly damaging Het
Pou2f1 A G 1: 165,891,830 V504A probably damaging Het
Prepl G A 17: 85,088,357 R66W probably damaging Het
Rasgrf2 T C 13: 92,030,888 K226E probably damaging Het
Ror1 T A 4: 100,412,109 F381L probably benign Het
Sbsn C T 7: 30,753,053 Q498* probably null Het
Scgb2b19 T C 7: 33,278,555 I106V probably benign Het
Sf3a2 G A 10: 80,804,206 probably benign Het
Sis T C 3: 72,934,142 H780R probably damaging Het
Slc28a3 G T 13: 58,558,575 C617* probably null Het
Slc44a1 T A 4: 53,561,006 V574D probably damaging Het
Slc8a3 T A 12: 81,315,986 T20S probably damaging Het
Stt3b T A 9: 115,254,927 I394F probably damaging Het
Ubap1l T A 9: 65,372,055 V212D possibly damaging Het
Ugt2b35 T C 5: 87,001,031 V47A probably benign Het
Vmn2r114 A G 17: 23,291,211 F765S probably damaging Het
Vps50 C T 6: 3,517,852 Q97* probably null Het
Vsig10 A G 5: 117,351,570 Q467R probably damaging Het
Wdsub1 T G 2: 59,878,133 Y11S probably damaging Het
Zbtb11 T G 16: 55,991,620 probably null Het
Other mutations in Nr1i3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01582:Nr1i3 APN 1 171214972 missense possibly damaging 0.79
IGL02401:Nr1i3 APN 1 171216373 splice site probably benign
IGL02964:Nr1i3 APN 1 171214395 missense probably benign 0.00
election UTSW 1 171216382 missense probably damaging 0.99
R0023:Nr1i3 UTSW 1 171217331 missense probably damaging 0.99
R0049:Nr1i3 UTSW 1 171214413 missense probably damaging 1.00
R0049:Nr1i3 UTSW 1 171214413 missense probably damaging 1.00
R0504:Nr1i3 UTSW 1 171217236 splice site probably benign
R1754:Nr1i3 UTSW 1 171217394 missense probably damaging 1.00
R1893:Nr1i3 UTSW 1 171217223 critical splice donor site probably null
R2116:Nr1i3 UTSW 1 171218594 missense probably damaging 1.00
R3613:Nr1i3 UTSW 1 171214995 nonsense probably null
R3787:Nr1i3 UTSW 1 171214425 missense probably damaging 1.00
R4627:Nr1i3 UTSW 1 171216445 missense probably benign 0.00
R4772:Nr1i3 UTSW 1 171217150 missense probably damaging 1.00
R4792:Nr1i3 UTSW 1 171218595 missense probably damaging 0.99
R4880:Nr1i3 UTSW 1 171216382 missense probably damaging 0.99
R5072:Nr1i3 UTSW 1 171216813 missense probably benign 0.11
R5349:Nr1i3 UTSW 1 171215072 missense possibly damaging 0.94
R5527:Nr1i3 UTSW 1 171214352 missense possibly damaging 0.91
R6768:Nr1i3 UTSW 1 171217397 missense probably damaging 1.00
R6824:Nr1i3 UTSW 1 171214973 missense probably benign 0.00
R7011:Nr1i3 UTSW 1 171214358 missense probably benign 0.02
R7092:Nr1i3 UTSW 1 171214178 splice site probably null
R7740:Nr1i3 UTSW 1 171216827 missense probably benign 0.00
R8200:Nr1i3 UTSW 1 171217697 missense probably benign 0.44
X0027:Nr1i3 UTSW 1 171214377 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tggtatgacatcctttagccttc -3'
Posted On2014-03-14